
Results for "COMMD10"

Variant Events: 51

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
COMMD10     AU2029301chr5:
GAintergenicDe novo--Yuen2017 G
COMMD10     AU2250301chr5:
GAintronicDe novo--Trost2022 G
COMMD10     1-1191-003chr5:
GAintronicDe novo--Trost2022 G
COMMD10     MSSNG00005-004chr5:
AGintronicDe novo--Trost2022 G
COMMD10     7-0100-004chr5:
GAintergenicDe novo--Yuen2017 G
COMMD10     2-1591-003chr5:
GAintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     2-1626-003chr5:
TAAAAAATAAAintronicDe novo--Yuen2017 G
COMMD10     2-1369-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
COMMD10     2-0145-004chr5:
TCintergenicDe novo--Yuen2017 G
COMMD10     2-0310-004chr5:
ATintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     1-0965-003chr5:
TCintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     1-0440-003chr5:
CGintronicDe novo--Yuen2017 G
COMMD10     AU4186302chr5:
TGintergenicDe novo--Yuen2017 G
COMMD10     2-0132-004chr5:
GAintergenicDe novo--Yuen2017 G
COMMD10     1-0210-004chr5:
AGintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     1-0494-003Achr5:
GAintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     1-0745-003chr5:
CGintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     2-1506-003chr5:
CTintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     AU3777301chr5:
CTintronicDe novo--Yuen2017 G
COMMD10     1-0357-003chr5:
GAintergenicDe novo--Yuen2017 G
COMMD10     2-1402-003chr5:
ACintergenicDe novo--Yuen2017 G
COMMD10     AU054304chr5:
GAintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     1-0200-004chr5:
TGintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     AU057404chr5:
CTintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     1-0494-003chr5:
GAintronicDe novo--Yuen2017 G
COMMD10     5-0026-003chr5:
TTTCintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     1-0065-005chr5:
AGintronicDe novo--Yuen2017 G
COMMD10     3-0169-000chr5:
AATintronicDe novo--Yuen2016 G
COMMD10     AU050603chr5:
AGintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     2-1386-003chr5:
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
COMMD10     AU4223302chr5:
CAintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     AU2072302chr5:
TGTCGTCGTTGTCGTintronicDe novo--Yuen2017 G
COMMD10     1-0901-003chr5:
ACintergenicDe novo--Yuen2017 G
COMMD10     SP0006028chr5:
GGACCGTTGGATGGCAGCTTintronicDe novo-8.426E-6Fu2022 E
COMMD10     13568.p1chr5:
AATintronicDe novo--Werling2018 G
COMMD10     1-0104-004chr5:
GTintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     1-0022-004chr5:
COMMD10     5-0055-004chr5:
GCCTGintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     A30chr5:
AGintronicDe novo--Wu2018 G
COMMD10     1-0359-003chr5:
GAintronicDe novo--Trost2022 G
Yuen2017 G
COMMD10     2-1129-003chr5:
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
COMMD10     7-0140-003chr5:
CTintergenicDe novo--Yuen2017 G
COMMD10     MSSNG00422-004chr5:
AGintronicDe novo--Trost2022 G
COMMD10     AU3915301chr5:
TAintronicDe novo--Yuen2017 G
COMMD10     4-0095-003chr5:
TCintronicDe novo--Trost2022 G
COMMD10     1032chr5:
AGintronicDe novo--Trost2022 G
COMMD10     MSSNG00349-003chr5:
GTintronicDe novo--Trost2022 G
COMMD10     1032chr5:
CGintronicDe novo--Trost2022 G
COMMD10     1032chr5:
CGintronicDe novo--Trost2022 G
COMMD10     2-1410-003chr5:
GAintronicDe novo--Trost2022 G
COMMD10     3-0497-000chr5:
AGintronicDe novo--Trost2022 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView