or
or
Exact

Results for "ROR2"

Variant Events: 37

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ROR2     1-0112-004chr9:
94632849-94632849
TGintronicDe novo--Trost2022 G
Yuen2017 G
ROR2     2-1131-003chr9:
94644320-94644320
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
ROR2     1-0218-004chr9:
94600467-94600467
CAintronicDe novo--Trost2022 G
Yuen2017 G
ROR2     1-0382-003chr9:
94668973-94668973
GAintronicDe novo--Trost2022 G
Yuen2017 G
ROR2     REACH000476chr9:
94486604-94486604
GAexonicDe novosynonymous SNVNM_004560c.C2172Tp.L724L--Trost2022 G
Zhou2022 GE
ROR2     3-0437-000chr9:
94733214-94733214
ACintergenicDe novo--Yuen2016 G
ROR2     13874.p1chr9:
94759166-94759166
CTintergenicDe novo--Turner2016 G
Werling2018 G
ROR2     1-0674-004chr9:
94490370-94490370
GAintronicDe novo--Yuen2017 G
ROR2     1-0153-004chr9:
94457676-94457676
GGCTTintergenicDe novo--Yuen2017 G
ROR2     2-1140-003chr9:
94605221-94605221
TCintronicDe novo--Yuen2017 G
ROR2     AU4237302chr9:
94685031-94685031
GAintronicDe novo--Trost2022 G
Yuen2017 G
ROR2     AU3053301chr9:
94763593-94763593
GAintergenicDe novo--Yuen2017 G
ROR2     5-0129-003chr9:
94457676-94457676
GGCTTintergenicDe novo--Yuen2017 G
ROR2     2-1235-003chr9:
94766011-94766011
CGintergenicDe novo--Yuen2017 G
ROR2     5-0055-003chr9:
94620273-94620273
GAintronicDe novo--Trost2022 G
Yuen2017 G
ROR2     2-1342-003chr9:
94791635-94791635
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ROR2     AU4452302chr9:
94777610-94777610
GAintergenicDe novo--Yuen2017 G
ROR2     1-0305-004chr9:
94457690-94457690
AATGTGTGTGGTGTGTGTCTGGTGTGTGTintergenicDe novo--Yuen2017 G
ROR2     AU046904chr9:
94440021-94440021
GTintergenicDe novo--Yuen2017 G
ROR2     5-0119-003chr9:
94617426-94617426
CTintronicDe novo--Trost2022 G
ROR2     3-0833-000chr9:
94633364-94633364
CTintronicDe novo--Trost2022 G
ROR2     3-0019-000chr9:
94597224-94597224
TCintronicDe novo--Trost2022 G
ROR2     1423_17auchr9:
94487380-94487380
TCexonicDe novononsynonymous SNVNM_004560c.A1396Gp.K466E10.28-Fu2022 E
ROR2     2-1281-003chr9:
94614929-94614933
ACACCAintronicDe novo--Trost2022 G
ROR2     1-0104-004chr9:
94573082-94573082
GAintronicDe novo--Trost2022 G
Yuen2017 G
ROR2     2-0309-004chr9:
94615732-94615732
GAintronicDe novo--Trost2022 G
Yuen2017 G
ROR2     5-0097-003chr9:
94566081-94566081
CTintronicDe novo--Trost2022 G
ROR2     MSSNG00377-003chr9:
94592249-94592249
TAintronicDe novo--Trost2022 G
ROR2     1-0054-003chr9:
94682158-94682158
TGintronicDe novo--Trost2022 G
Yuen2017 G
ROR2     3-0460-000chr9:
94543847-94543847
GAintronicDe novo--Trost2022 G
ROR2     MSSNG00101-004chr9:
94698773-94698773
GTintronicDe novo--Trost2022 G
ROR2     5-1007-003chr9:
94674246-94674246
CAintronicDe novo--Trost2022 G
ROR2     MSSNG00424-003chr9:
94680380-94680380
CTintronicDe novo--Trost2022 G
ROR2     MSSNG00354-004chr9:
94654072-94654072
GAintronicDe novo--Trost2022 G
ROR2     REACH000537chr9:
94673216-94673216
GAintronicDe novo--Trost2022 G
ROR2     AU2764301chr9:
94645653-94645653
CTintronicDe novo--Trost2022 G
ROR2     2-1552-003chr9:
94649890-94649890
TCintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More