or
or
Exact

Results for "RFPL4B"

Variant Events: 66

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RFPL4B     1-0445-003chr6:
113751781-113751781
CAintergenicDe novo--Yuen2017 G
RFPL4B     1-0402-004chr6:
113198913-113198913
AGintergenicDe novo--Yuen2017 G
RFPL4B     AU1698302chr6:
113133645-113133645
TAintergenicDe novo--Yuen2017 G
RFPL4B     AU066404chr6:
113616125-113616125
TCintergenicDe novo--Yuen2017 G
RFPL4B     2-1337-003chr6:
113417056-113417056
CTintergenicDe novo--Yuen2017 G
RFPL4B     1-0139-005chr6:
113822136-113822136
GCintergenicDe novo--Yuen2017 G
RFPL4B     1-0533-003chr6:
112802619-112802619
AGintergenicDe novo--Yuen2017 G
RFPL4B     2-1411-003chr6:
113633735-113633736
TCTintergenicDe novo--Yuen2017 G
RFPL4B     1-0389-004chr6:
113397187-113397187
ATintergenicDe novo--Yuen2017 G
RFPL4B     7-0161-003chr6:
113006211-113006211
CAintergenicDe novo--Yuen2017 G
RFPL4B     AU057405chr6:
112785029-112785029
TCintergenicDe novo--Yuen2017 G
RFPL4B     AU4024303chr6:
113685841-113685841
GCintergenicDe novo--Yuen2017 G
RFPL4B     1-0006-003chr6:
112916898-112916898
CAintergenicDe novo--Yuen2017 G
RFPL4B     1-0208-003chr6:
113603801-113603801
CTintergenicDe novo--Yuen2017 G
RFPL4B     A26chr6:
113741454-113741454
GAintergenicDe novo--Wu2018 G
RFPL4B     AU1521301chr6:
112690884-112690884
TCintergenicDe novo--Yuen2017 G
RFPL4B     5-0030-003chr6:
113017929-113017929
CGintergenicDe novo--Yuen2017 G
RFPL4B     5-0050-004chr6:
113816260-113816260
TAintergenicDe novo--Yuen2017 G
RFPL4B     AU1764301chr6:
113747120-113747120
AGintergenicDe novo--Yuen2017 G
RFPL4B     2-1327-004chr6:
113500444-113500444
GAintergenicDe novo--Yuen2017 G
RFPL4B     AU4215302chr6:
113187521-113187521
CTintergenicDe novo--Yuen2017 G
RFPL4B     AU3861302chr6:
112768222-112768222
ATintergenicDe novo--Yuen2017 G
RFPL4B     AU002903chr6:
113069317-113069317
AGintergenicDe novo--Yuen2017 G
RFPL4B     1-0214-003chr6:
113335673-113335673
CTintergenicDe novo--Yuen2017 G
RFPL4B     1-0638-003chr6:
113412585-113412585
CTintergenicDe novo--Yuen2017 G
RFPL4B     2-1518-003chr6:
112799557-112799557
TAintergenicDe novo--Yuen2017 G
RFPL4B     AU012804chr6:
112945906-112945906
GAintergenicDe novo--Yuen2017 G
RFPL4B     AU2308301chr6:
112672677-112672677
TAdownstreamDe novo--Trost2022 G
RFPL4B     AU3790301chr6:
113513686-113513686
CTintergenicDe novo--Yuen2017 G
RFPL4B     1-0443-003chr6:
113102052-113102052
TGintergenicDe novo--Yuen2016 G
RFPL4B     2-1430-003chr6:
112712671-112712671
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
RFPL4B     AU4149301chr6:
112876878-112876878
CTintergenicDe novo--Yuen2017 G
RFPL4B     1-0479-006chr6:
113821341-113821341
CGintergenicDe novo--Yuen2017 G
RFPL4B     1-0382-003chr6:
112934037-112934037
CGintergenicDe novo--Yuen2017 G
RFPL4B     AU2248301chr6:
113700041-113700041
CAintergenicDe novo--Yuen2017 G
RFPL4B     1-0455-004chr6:
113395039-113395039
CCAAAACAATCAAATGTCCATCAATGGGAAAATTTCAAAAintergenicDe novo--Yuen2017 G
RFPL4B     AU066206chr6:
113370505-113370505
CTintergenicDe novo--Yuen2017 G
RFPL4B     AU4067303chr6:
113445426-113445426
GCintergenicDe novo--Yuen2017 G
RFPL4B     5-0026-003chr6:
113666680-113666680
CTintergenicDe novo--Yuen2017 G
RFPL4B     1-0547-003chr6:
113663390-113663390
ATintergenicDe novo--Yuen2017 G
RFPL4B     2-0045-003chr6:
113635604-113635604
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
RFPL4B     2-1477-003chr6:
113213114-113213114
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
RFPL4B     AU4463303chr6:
113769816-113769816
GAintergenicDe novo--Yuen2017 G
RFPL4B     2-1246-003chr6:
112672433-112672433
ACUTR3De novo--Trost2022 G
Yuen2017 G
RFPL4B     1-0272-004chr6:
112905014-112905014
AGintergenicDe novo--Yuen2017 G
RFPL4B     1-0295-003chr6:
113100251-113100251
TAintergenicDe novo--Yuen2017 G
RFPL4B     1-0699-003chr6:
112961627-112961627
TCintergenicDe novo--Yuen2017 G
RFPL4B     1-0489-003chr6:
113912982-113912982
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
RFPL4B     2-1292-003chr6:
113016518-113016527
AGGAAGAGCTAintergenicDe novo--Yuen2017 G
RFPL4B     5-0077-003chr6:
113840794-113840798
AAATGAintergenicDe novo--Yuen2017 G
RFPL4B     2-0002-005chr6:
112735951-112735951
AGintergenicDe novo--Yuen2017 G
RFPL4B     2-1231-003chr6:
112821593-112821607
CTATATATATATATACTATATATATATAintergenicDe novo--Yuen2017 G
RFPL4B     1-0051-004chr6:
113764883-113764886
AGAGAintergenicDe novo--Yuen2017 G
RFPL4B     AU0636303chr6:
113054342-113054342
AGintergenicDe novo--Yuen2017 G
RFPL4B     AU4250301chr6:
113092330-113092330
AGintergenicDe novo--Yuen2017 G
RFPL4B     G01-GEA-27-HIchr6:
112671692-112671692
TCexonicDe novononsynonymous SNVNM_001013734c.T782Cp.I261T14.6-Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
RFPL4B     AU021204chr6:
113522158-113522158
GAintergenicDe novo--Yuen2017 G
RFPL4B     2-1409-003chr6:
113679642-113679642
GAintergenicDe novo--Yuen2017 G
RFPL4B     AU2140305chr6:
112853890-112853890
CTintergenicDe novo--Yuen2017 G
RFPL4B     AU2140305 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
RFPL4B     1-0253-004chr6:
112798754-112798754
CTintergenicDe novo--Yuen2017 G
RFPL4B     1-0028-003chr6:
113400374-113400374
CTintergenicDe novo--Yuen2017 G
RFPL4B     2-0018-004chr6:
113242884-113242884
TCintergenicDe novo--Yuen2017 G
RFPL4B     1-0139-003chr6:
113801490-113801490
TGintergenicDe novo--Yuen2017 G
RFPL4B     AU3984301chr6:
112796931-112796931
GTintergenicDe novo--Yuen2017 G
RFPL4B     13403.p1chr6:
113164741-113164741
GAintergenicDe novo--Werling2018 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More