or
or
Exact

Results for "LPP"

Variant Events: 89

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LPP     2-1626-003chr3:
187936093-187936093
TCintronicDe novo--Trost2022 G
Yuen2017 G
LPP     3-0376-000chr3:
188469417-188469417
ATintronicDe novo--Trost2022 G
LPP     1-1129-003chr3:
188526439-188526439
TGintronicDe novo--Trost2022 G
LPP     1-0465-003achr3:
188635305-188635305
CTintergenicDe novo--Yuen2017 G
LPP     AU004403chr3:
188445006-188445006
TAintronicDe novo--Trost2022 G
LPP     1-1122-003chr3:
188466594-188466594
GTintronicDe novo--Trost2022 G
LPP     7-0461-003chr3:
188417314-188417314
GAintronicDe novo--Trost2022 G
LPP     MSSNG00227-003chr3:
188418864-188418864
TCintronicDe novo--Trost2022 G
LPP     2-0142-004chr3:
188387592-188387592
GAintronicDe novo--Trost2022 G
Yuen2017 G
LPP     MSSNG00253-003chr3:
188386706-188386706
CTintronicDe novo--Trost2022 G
LPP     3-0270-000chr3:
188406150-188406150
CGintronicDe novo--Trost2022 G
LPP     13649.p1chr3:
188390698-188390698
AGintronicDe novo--Turner2016 G
LPP     REACH000721chr3:
188606776-188606776
AGUTR3De novo--Trost2022 G
LPP     14370.p1chr3:
187921770-187921770
TCintronicDe novo--Turner2016 G
LPP     1-0539-003chr3:
188522773-188522773
TCintronicDe novo--Trost2022 G
Yuen2017 G
LPP     AU3760302chr3:
188370774-188370774
AGintronicDe novo--Yuen2017 G
LPP     3-0432-000chr3:
188640955-188640955
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
LPP     AU2108302chr3:
188634282-188634282
CTintergenicDe novo--Yuen2017 G
LPP     A1chr3:
187881835-187881835
TCintronicDe novo--Wu2018 G
LPP     SP0068632chr3:
188478137-188478137
CGintronicDe novo--Fu2022 E
LPP     2-1265-003chr3:
187980520-187980533
TCACACACACACACTCACACACACACintronicDe novo--Yuen2017 G
LPP     1-0043-004chr3:
188361542-188361542
CTintronicDe novo--Trost2022 G
Yuen2017 G
LPP     5-0042-003chr3:
188445987-188445987
CTintronicDe novo--Trost2022 G
Yuen2017 G
LPP     1-0465-003chr3:
188635305-188635305
CTintergenicDe novo--Yuen2017 G
LPP     2-1633-003chr3:
188271840-188271840
CAintronicDe novo--Yuen2017 G
LPP     1-0534-006chr3:
188299194-188299194
GCintronicDe novo--Trost2022 G
Yuen2017 G
LPP     AU074503chr3:
188375457-188375457
TCintronicDe novo--Trost2022 G
Yuen2017 G
LPP     2-1741-003chr3:
188525516-188525516
TCintronicDe novo--Trost2022 G
Yuen2017 G
LPP     AU3761302chr3:
188241441-188241445
CTTTTCTTintronicDe novo--Yuen2017 G
LPP     11954.p1chr3:
188200887-188200887
TAintronicDe novo--Werling2018 G
LPP     1-0112-003chr3:
188172393-188172396
GGAAGintronicDe novo--Trost2022 G
Yuen2017 G
LPP     1-0986-003chr3:
188491783-188491783
TGintronicDe novo--Trost2022 G
Yuen2017 G
LPP     AU4183301chr3:
187884065-187884065
ATintronicDe novo--Trost2022 G
Yuen2017 G
LPP     AU050910chr3:
187955106-187955106
GTintronicDe novo--Yuen2017 G
LPP     2-1280-003chr3:
188546359-188546359
CTintronicDe novo--Yuen2016 G
Yuen2017 G
LPP     2-1094-004chr3:
188010329-188010329
GAintronicDe novo--Trost2022 G
Yuen2017 G
LPP     2-1800-003chr3:
187902003-187902003
CTintronicDe novo--Trost2022 G
LPP     MSSNG00329-004chr3:
187926409-187926409
CTintronicDe novo--Trost2022 G
LPP     3-0380-000chr3:
187872855-187872855
ACintronicDe novo--Trost2022 G
LPP     1-0562-003chr3:
187881889-187881889
CTintronicDe novo--Trost2022 G
LPP     2-0144-003chr3:
187991572-187991572
TCintronicDe novo--Trost2022 G
LPP     2-0144-004chr3:
187991572-187991572
TCintronicDe novo--Trost2022 G
LPP     3-0393-000chr3:
187963050-187963050
GAintronicDe novo--Trost2022 G
LPP     MSSNG00251-003chr3:
187971194-187971194
GTintronicDe novo--Trost2022 G
LPP     AU2320301chr3:
187958428-187958428
ATintronicDe novo--Trost2022 G
LPP     AU2320301chr3:
187958430-187958430
ACintronicDe novo--Trost2022 G
LPP     5-0009-003chr3:
187954323-187954323
AGintronicDe novo--Trost2022 G
LPP     AU2320301chr3:
187957960-187957960
AGintronicDe novo--Trost2022 G
LPP     5-1009-003chr3:
188047339-188047341
CTGTCAintronicDe novo--Trost2022 G
LPP     MT_179.3chr3:
188066784-188066784
ATintronicDe novo--Trost2022 G
LPP     MSSNG00029-003chr3:
188014611-188014611
CGintronicDe novo--Trost2022 G
LPP     7-0166-003chr3:
188025165-188025165
TCintronicDe novo--Trost2022 G
LPP     2-0144-003chr3:
187991595-187991596
ACGAintronicDe novo--Trost2022 G
LPP     MT_16.3chr3:
187995582-187995582
TGintronicDe novo--Trost2022 G
LPP     2-0144-003chr3:
187991584-187991584
ATintronicDe novo--Trost2022 G
LPP     AU3782303chr3:
188197785-188197785
GAintronicDe novo--Trost2022 G
Yuen2017 G
LPP     2-0144-003chr3:
187991589-187991589
GAintronicDe novo--Trost2022 G
LPP     3-0328-000chr3:
188134138-188134138
TAintronicDe novo--Trost2022 G
LPP     7-0453-003chr3:
188152550-188152550
CTintronicDe novo--Trost2022 G
LPP     MSSNG00015-004chr3:
188114459-188114459
GAintronicDe novo--Trost2022 G
LPP     MSSNG00357-003chr3:
188117784-188117784
TAintronicDe novo--Trost2022 G
LPP     3-0787-000chr3:
188081465-188081465
CTintronicDe novo--Trost2022 G
LPP     AU1223303chr3:
187935972-187935972
GAintronicDe novo--Yuen2017 G
LPP     1-1024-003chr3:
188097113-188097114
TGTintronicDe novo--Trost2022 G
LPP     1-1204-003chr3:
188069009-188069009
TCintronicDe novo--Trost2022 G
LPP     AU2717301chr3:
188072805-188072805
TCintronicDe novo--Trost2022 G
LPP     4-0062-003chr3:
188267408-188267409
GTATCintronicDe novo--Trost2022 G
LPP     1-1026-003chr3:
188275914-188275914
TCintronicDe novo--Trost2022 G
LPP     V5T5W_01chr3:
188203633-188203633
TAintronicDe novo--Trost2022 G
LPP     MSSNG00165-003chr3:
188206641-188206641
GTintronicDe novo--Trost2022 G
LPP     AU058104chr3:
188225205-188225205
CAintronicDe novo--Trost2022 G
Yuen2017 G
LPP     MSSNG00033-003chr3:
188184040-188184040
GAintronicDe novo--Trost2022 G
LPP     3-0783-000chr3:
188196572-188196572
CTintronicDe novo--Trost2022 G
LPP     5-0068-003chr3:
188169985-188169985
GAintronicDe novo--Trost2022 G
LPP     1-1005-004chr3:
188173706-188173706
ATintronicDe novo--Trost2022 G
LPP     7-0303-003chr3:
188341458-188341458
GAintronicDe novo--Trost2022 G
LPP     2-1521-003chr3:
188026664-188026664
GAintronicDe novo--Yuen2017 G
LPP     MSSNG00359-004chr3:
188376298-188376298
TCintronicDe novo--Trost2022 G
LPP     1-0330-004chr3:
188310375-188310376
CAGGintronicDe novo--Trost2022 G
LPP     AU3885304chr3:
188143828-188143828
CTintronicDe novo--Yuen2017 G
LPP     1-0202-003chr3:
188314746-188314746
GTintronicDe novo--Trost2022 G
LPP     AU2328301chr3:
188301239-188301239
CAintronicDe novo--Trost2022 G
LPP     2-1591-003chr3:
188088321-188088321
CTintronicDe novo--Trost2022 G
Yuen2017 G
LPP     AU3787302chr3:
188043060-188043060
CTintronicDe novo--Trost2022 G
Yuen2017 G
LPP     1-0458-003chr3:
188310331-188310334
TTAGGTTTintronicDe novo--Trost2022 G
LPP     1-0329-003chr3:
188310341-188310341
TTGintronicDe novo--Yuen2017 G
LPP     2-1264-003chr3:
188379255-188379255
CTintronicDe novo--Trost2022 G
Yuen2017 G
LPP     5-0009-003chr3:
188299493-188299493
TCintronicDe novo--Trost2022 G
LPP     5-0009-003chr3:
188299524-188299524
AGintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More