or
or
Exact

Results for "CCSER1"

Variant Events: 220

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CCSER1     08C76149chr4:
91563087-91563087
TCintronicDe novo--Fu2022 E
CCSER1     2-1342-003chr4:
91080353-91080374
TTTATTATTATTATTATTATTATTTATTATTATTATTATTAintronicDe novo--Yuen2017 G
CCSER1     7-0135-003chr4:
92375550-92375550
AGintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     200675527_1082035040chr4:
91234171-91234171
TAexonicDe novosynonymous SNVNM_001145065
NM_207491
c.T1482A
c.T1482A
p.G494G
p.G494G
--Fu2022 E
CCSER1     3-0456-000chr4:
92633846-92633849
CTATCTATATintergenicDe novo--Yuen2017 G
CCSER1     AU072004chr4:
92726309-92726309
TCintergenicDe novo--Yuen2017 G
CCSER1     12568.p1chr4:
91309989-91309989
TCintronicDe novo--Turner2016 G
CCSER1     AU2248302chr4:
91871113-91871113
GAintronicDe novo--Yuen2017 G
CCSER1     7-0446-003chr4:
92519867-92519867
CGexonicDe novononsynonymous SNVNM_001145065c.C2362Gp.L788V11.53-Trost2022 G
Zhou2022 GE
CCSER1     12680.p1chr4:
91309992-91309992
GAintronicDe novo--Turner2016 G
CCSER1     AU2108302chr4:
92297994-92297994
GTintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     12793.p1chr4:
91993119-91993119
AGintronicDe novo--Turner2016 G
CCSER1     12680.p1chr4:
91309989-91309989
TCintronicDe novo--Turner2016 G
CCSER1     12568.p1chr4:
91309992-91309992
GAintronicDe novo--Turner2016 G
CCSER1     AU3721301chr4:
92478874-92478874
CTintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     2-0304-004chr4:
92616662-92616662
GCintergenicDe novo--Yuen2017 G
CCSER1     AU3808305chr4:
92543021-92543021
TCintergenicDe novo--Yuen2017 G
CCSER1     2-1306-003chr4:
91215915-91215915
CCATGintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU3794301chr4:
93088484-93088484
TCintergenicDe novo--Yuen2017 G
CCSER1     A22chr4:
93177664-93177664
TCintergenicDe novo--Wu2018 G
CCSER1     2-1430-003chr4:
92431839-92431839
TCintronicDe novo--Yuen2016 G
Yuen2017 G
CCSER1     1-0065-005chr4:
92454018-92454018
CTintronicDe novo--Yuen2017 G
CCSER1     1-0338-005chr4:
93178071-93178071
TGintergenicDe novo--Yuen2017 G
CCSER1     3-0236-000chr4:
91139228-91139228
AGintronicDe novo--Trost2022 G
CCSER1     AU059003chr4:
91159660-91159660
TGintronicDe novo--Trost2022 G
CCSER1     REACH000233chr4:
91129389-91129389
TCintronicDe novo--Trost2022 G
CCSER1     3-0456-000Bchr4:
92633846-92633849
CTATCTATATintergenicDe novo--Yuen2017 G
CCSER1     MSSNG00384-003chr4:
91138596-91138596
GAintronicDe novo--Trost2022 G
CCSER1     7-0419-003chr4:
91104186-91104186
TCintronicDe novo--Trost2022 G
CCSER1     2-1297-004chr4:
91128140-91128140
GTintronicDe novo--Trost2022 G
CCSER1     REACH000517chr4:
91278597-91278597
CTintronicDe novo--Trost2022 G
CCSER1     2-0244-003chr4:
91293632-91293632
CTGintronicDe novo--Trost2022 G
CCSER1     3-0519-000chr4:
91268607-91268607
AGintronicDe novo--Trost2022 G
CCSER1     A9chr4:
91489672-91489672
ATintronicDe novo--Wu2018 G
CCSER1     3-0504-000chr4:
91269518-91269518
CAintronicDe novo--Trost2022 G
CCSER1     3-0456-000Bchr4:
92880411-92880412
TATAAintergenicDe novo--Yuen2017 G
CCSER1     MSSNG00337-003chr4:
91215785-91215785
CTintronicDe novo--Trost2022 G
CCSER1     AU055603 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
CCSER1     NDAR_INVCX994GUN_wes1chr4:
91549237-91549237
CTexonicDe novostopgainNM_001145065
NM_207491
c.C1786T
c.C1786T
p.R596X
p.R596X
18.08.284E-6DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
CCSER1     REACH000701chr4:
91199091-91199091
ACintronicDe novo--Trost2022 G
CCSER1     MSSNG00108-003chr4:
91210145-91210145
AGintronicDe novo--Trost2022 G
CCSER1     2-1362-003chr4:
92294964-92294964
GAintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     2-1467-003chr4:
91305229-91305229
GAintronicDe novo--Trost2022 G
CCSER1     2-1362-003chr4:
91657348-91657348
GAintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     3-0352-000chr4:
91311685-91311685
GAintronicDe novo--Trost2022 G
CCSER1     2-1290-003chr4:
91293751-91293751
TAintronicDe novo--Trost2022 G
CCSER1     2-1743-003Achr4:
91303299-91303299
AGintronicDe novo--Trost2022 G
CCSER1     3-0703-000chr4:
91293745-91293746
CCACAintronicDe novo--Trost2022 G
CCSER1     2-1290-003chr4:
91293745-91293746
CCACAintronicDe novo--Trost2022 G
CCSER1     3-0703-000chr4:
91293727-91293727
TCintronicDe novo--Trost2022 G
CCSER1     3-0703-000chr4:
91293730-91293730
AGintronicDe novo--Trost2022 G
CCSER1     MSSNG00020-003chr4:
91488188-91488192
CAAAACintronicDe novo--Trost2022 G
CCSER1     MSSNG00239-003chr4:
91526098-91526098
ACintronicDe novo--Trost2022 G
CCSER1     MSSNG00352-003chr4:
91403828-91403828
CTintronicDe novo--Trost2022 G
CCSER1     MSSNG00024-004chr4:
91420141-91420141
TCintronicDe novo--Trost2022 G
CCSER1     5-0009-003chr4:
91328553-91328553
ATintronicDe novo--Trost2022 G
CCSER1     5-5123-004chr4:
91393688-91393688
AGintronicDe novo--Trost2022 G
CCSER1     2-0057-004chr4:
92813750-92813750
CTintergenicDe novo--Yuen2017 G
CCSER1     4-0019-003chr4:
91318370-91318370
ATintronicDe novo--Trost2022 G
CCSER1     5-5146-005chr4:
91320346-91320346
TCintronicDe novo--Trost2022 G
CCSER1     4-0047-003chr4:
91664802-91664802
ACintronicDe novo--Trost2022 G
CCSER1     AU2310301chr4:
91674524-91674524
TCintronicDe novo--Trost2022 G
CCSER1     AU2310301chr4:
91605792-91605792
ACintronicDe novo--Trost2022 G
CCSER1     1-0413-003chr4:
92163059-92163059
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CCSER1     AU2283301chr4:
91661791-91661791
TGintronicDe novo--Trost2022 G
CCSER1     1-0465-003Achr4:
91552433-91552433
AGintronicDe novo--Trost2022 G
CCSER1     AU2227301chr4:
91585228-91585228
CCAAATintronicDe novo--Trost2022 G
CCSER1     AU2310301chr4:
91531636-91531636
ACintronicDe novo--Trost2022 G
CCSER1     AU2310301chr4:
91537482-91537482
TGintronicDe novo--Trost2022 G
CCSER1     AU2320301chr4:
91855041-91855041
GAintronicDe novo--Trost2022 G
CCSER1     3-0174-000chr4:
91855141-91855141
TTAintronicDe novo--Trost2022 G
CCSER1     1-0045-004chr4:
92772722-92772722
GCintergenicDe novo--Yuen2017 G
CCSER1     5-5046-007chr4:
91821132-91821132
TTCintronicDe novo--Trost2022 G
CCSER1     3-0103-000chr4:
91836682-91836682
AGintronicDe novo--Trost2022 G
CCSER1     SP0183680chr4:
91702573-91702573
CGUTR3De novo--Trost2022 G
CCSER1     1-0338-003chr4:
91774106-91774106
GAintronicDe novo--Trost2022 G
CCSER1     MT_13.3chr4:
91682290-91682290
CTintronicDe novo--Trost2022 G
CCSER1     AU2310301chr4:
91700367-91700367
ACintronicDe novo--Trost2022 G
CCSER1     4-0090-003chr4:
91949917-91949917
CTintronicDe novo--Trost2022 G
CCSER1     1-0288-004chr4:
91956953-91956953
GAintronicDe novo--Trost2022 G
CCSER1     AU2075302chr4:
92866308-92866308
GAintergenicDe novo--Yuen2017 G
CCSER1     14-600chr4:
91918940-91918940
TGintronicDe novo--Trost2022 G
CCSER1     1-0028-003chr4:
92582239-92582239
GTintergenicDe novo--Yuen2017 G
CCSER1     2-1774-003chr4:
91941800-91941800
GAintronicDe novo--Trost2022 G
CCSER1     7-0008-003chr4:
93133892-93133892
CGintergenicDe novo--Yuen2017 G
CCSER1     1-0845-003chr4:
91892488-91892488
TAintronicDe novo--Trost2022 G
CCSER1     216287chr4:
91901326-91901326
GAintronicDe novo--Trost2022 G
CCSER1     1-0184-003chr4:
92988401-92988419
CAATAAATAAATAAATAAACAATAAATAAATAAAintergenicDe novo--Yuen2017 G
CCSER1     REACH000613chr4:
91877217-91877221
TGTAGTintronicDe novo--Trost2022 G
CCSER1     1-0336-004chr4:
91888361-91888361
GAintronicDe novo--Trost2022 G
CCSER1     MSSNG00418-003chr4:
92027569-92027569
AGintronicDe novo--Trost2022 G
CCSER1     2-1425-004chr4:
92045670-92045670
TCintronicDe novo--Trost2022 G
CCSER1     MSSNG00108-004chr4:
91991323-91991323
ACintronicDe novo--Trost2022 G
CCSER1     1045chr4:
92000469-92000469
CAintronicDe novo--Trost2022 G
CCSER1     4-0062-003chr4:
91972801-91972802
GGAAintronicDe novo--Trost2022 G
CCSER1     4-0073-003chr4:
91972801-91972802
GGAAintronicDe novo--Trost2022 G
CCSER1     2-0112-005chr4:
91970897-91970897
TCintronicDe novo--Trost2022 G
CCSER1     1-0051-005chr4:
91972801-91972802
GGAAintronicDe novo--Trost2022 G
CCSER1     MSSNG00040-003chr4:
92156450-92156450
ACintronicDe novo--Trost2022 G
CCSER1     AU2283301chr4:
92178750-92178750
ACintronicDe novo--Trost2022 G
CCSER1     7-0161-003chr4:
91258380-91258380
CTintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     3-0116-001chr4:
92099801-92099801
AGintronicDe novo--Trost2022 G
CCSER1     3-0221-000chr4:
92102978-92102979
GGATintronicDe novo--Trost2022 G
CCSER1     REACH000288chr4:
92078694-92078694
GAintronicDe novo--Trost2022 G
CCSER1     MSSNG00378-003chr4:
92091524-92091524
AGintronicDe novo--Trost2022 G
CCSER1     2-1425-004chr4:
92045675-92045675
CTintronicDe novo--Trost2022 G
CCSER1     MSSNG00045-003chr4:
92061595-92061595
ATintronicDe novo--Trost2022 G
CCSER1     1-0980-003chr4:
92288300-92288302
AAGAintronicDe novo--Trost2022 G
CCSER1     3-0066-001chr4:
92307114-92307114
TCintronicDe novo--Trost2022 G
CCSER1     2-1437-004chr4:
92200258-92200259
GGCTintronicDe novo--Trost2022 G
CCSER1     1-0052-004chr4:
92291716-92291716
CAintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     MSSNG00344-003chr4:
92284560-92284563
AAAGAintronicDe novo--Trost2022 G
CCSER1     7-0390-003chr4:
92194738-92194738
TCintronicDe novo--Trost2022 G
CCSER1     1-1039-003chr4:
92198847-92198847
AGintronicDe novo--Trost2022 G
CCSER1     AU2310301chr4:
92185704-92185704
TGintronicDe novo--Trost2022 G
CCSER1     AU055603chr4:
92193604-92193604
TCintronicDe novo--Trost2022 G
CCSER1     1-1210-003chr4:
92429813-92429813
GCintronicDe novo--Trost2022 G
CCSER1     7-0458-003chr4:
92430351-92430351
AGintronicDe novo--Trost2022 G
CCSER1     MSSNG00102-003chr4:
92380111-92380111
ACintronicDe novo--Trost2022 G
CCSER1     1-0572-003chr4:
91671183-91671183
CTintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU1987302chr4:
92221591-92221591
ACintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU2283301chr4:
92406309-92406310
TATintronicDe novo--Trost2022 G
CCSER1     1-0539-003chr4:
91199340-91199340
ATintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU1448303chr4:
92357570-92357570
ATintronicDe novo--Trost2022 G
CCSER1     1-0779-003chr4:
92365084-92365084
CTintronicDe novo--Trost2022 G
CCSER1     MSSNG00213-003chr4:
92307841-92307841
CTintronicDe novo--Trost2022 G
CCSER1     7-0202-003chr4:
92353717-92353717
CTintronicDe novo--Trost2022 G
CCSER1     2-1306-004chr4:
91215915-91215915
CCATGintronicDe novo--Yuen2017 G
CCSER1     5-5177-003chr4:
92477675-92477677
CTTCintronicDe novo--Trost2022 G
CCSER1     1-0215-006chr4:
92199293-92199293
TCintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     1-1134-004chr4:
92479522-92479522
GAintronicDe novo--Trost2022 G
CCSER1     2-1430-003Achr4:
92431839-92431839
TCintronicDe novo--Trost2022 G
CCSER1     7-0429-003chr4:
92463836-92463836
GAintronicDe novo--Trost2022 G
CCSER1     2-1460-003chr4:
91116800-91116800
CAintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU4429301chr4:
92736626-92736627
ATAintergenicDe novo--Yuen2017 G
CCSER1     1-0357-003chr4:
93102672-93102682
TATGAGCCAGCTintergenicDe novo--Yuen2017 G
CCSER1     1-0465-003chr4:
91552433-91552433
AGintronicDe novo--Yuen2017 G
CCSER1     7-0035-003chr4:
92040271-92040271
ACintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     2-0003-003chr4:
92063553-92063553
TCintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU2787302chr4:
93093385-93093385
CGintergenicDe novo--Yuen2017 G
CCSER1     AU4089301chr4:
92752136-92752136
GTintergenicDe novo--Yuen2017 G
CCSER1     2-1330-003chr4:
92421509-92421509
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CCSER1     AU072504chr4:
92140687-92140687
CTintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU3057302chr4:
92634296-92634296
CTintergenicDe novo--Yuen2017 G
CCSER1     12738.p1chr4:
91538812-91538812
GTintronicDe novo--Werling2018 G
CCSER1     1-0772-003chr4:
92561601-92561601
GTintergenicDe novo--Yuen2017 G
CCSER1     3-0431-000chr4:
91959873-91959873
CGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CCSER1     AU3729301chr4:
92566876-92566876
TCintergenicDe novo--Yuen2017 G
CCSER1     AU3702307chr4:
91825820-91825820
GAintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU1933302chr4:
91413665-91413665
CTintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     1-0593-003chr4:
92721297-92721297
TCintergenicDe novo--Yuen2017 G
CCSER1     1-0272-003chr4:
91543068-91543068
TGintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     2-1280-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
CCSER1     2-1511-003chr4:
91748402-91748402
CTintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU3787302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
CCSER1     2-1148-004chr4:
91936101-91936101
GGATTCCTintronicDe novo--Yuen2017 G
CCSER1     1-0579-003chr4:
91877137-91877150
TTATATATATATATTTATATATATATintronicDe novo--Yuen2017 G
CCSER1     2-1526-003chr4:
91066196-91066196
AGintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     1-0736-003chr4:
92740868-92740873
TCTCCTTCTintergenicDe novo--Yuen2017 G
CCSER1     mAGRE2412chr4:
91229448-91229448
GTexonicPaternalstopgainNM_001145065
NM_207491
c.G13T
c.G13T
p.G5X
p.G5X
38.0-Cirnigliaro2023 G
CCSER1     mAGRE2411chr4:
91229448-91229448
GTexonicPaternalstopgainNM_001145065
NM_207491
c.G13T
c.G13T
p.G5X
p.G5X
38.0-Cirnigliaro2023 G
CCSER1     mAGRE2410chr4:
91229448-91229448
GTexonicPaternalstopgainNM_001145065
NM_207491
c.G13T
c.G13T
p.G5X
p.G5X
38.0-Cirnigliaro2023 G
CCSER1     2-0135-003chr4:
92636716-92636716
TTAintergenicDe novo--Yuen2017 G
CCSER1     AU2035301chr4:
92567934-92567934
AGintergenicDe novo--Yuen2017 G
CCSER1     mAGRE2409chr4:
91229448-91229448
GTexonicPaternalstopgainNM_001145065
NM_207491
c.G13T
c.G13T
p.G5X
p.G5X
38.0-Cirnigliaro2023 G
CCSER1     1-0465-003achr4:
91552433-91552433
AGintronicDe novo--Yuen2017 G
CCSER1     2-1635-004chr4:
91293638-91293638
GCintronicDe novo--Yuen2017 G
CCSER1     1-0640-003chr4:
91272386-91272388
ATTATintronicDe novo--Yuen2017 G
CCSER1     1-0440-003chr4:
92563941-92563941
CTintergenicDe novo--Yuen2017 G
CCSER1     3-0438-000chr4:
92118966-92118966
CTintronicDe novo--Trost2022 G
Yuen2016 G
CCSER1     200675527@1082035040chr4:
91234171-91234171
TAexonicDe novosynonymous SNVNM_001145065
NM_207491
c.T1482A
c.T1482A
p.G494G
p.G494G
--Satterstrom2020 E
Trost2022 G
Zhou2022 GE
CCSER1     AU1988301chr4:
93087930-93087930
CTintergenicDe novo--Yuen2017 G
CCSER1     AU3052301 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
CCSER1     AU4122301chr4:
91078286-91078286
CTintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     2-1317-003chr4:
92817484-92817484
AGintergenicDe novo--Yuen2017 G
CCSER1     7-0219-003chr4:
91223769-91223769
TCintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     1-0874-003chr4:
92000191-92000191
GAintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU4070301chr4:
92191229-92191229
ATintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU4212303chr4:
91528151-91528151
ATintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     2-0145-003chr4:
92896421-92896421
GTintergenicDe novo--Yuen2017 G
CCSER1     2-1617-003chr4:
92015850-92015850
CTintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU3951301chr4:
92335778-92335778
AGintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     2-0135-004chr4:
92416142-92416142
CTintronicDe novo--Yuen2017 G
CCSER1     AU2035302chr4:
92567934-92567934
AGintergenicDe novo--Yuen2017 G
CCSER1     1-0651-003chr4:
91559616-91559616
TCintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU3725302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
CCSER1     7-0168-003chr4:
92379704-92379704
GCintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     2-1693-003chr4:
93032556-93032556
CGintergenicDe novo--Yuen2017 G
CCSER1     1-0512-003chr4:
91800618-91800634
TATAATAATAATAATAATATAATAATAATAAintronicDe novo--Yuen2017 G
CCSER1     AU3398301chr4:
92769858-92769858
GAintergenicDe novo--Yuen2017 G
CCSER1     AU054103chr4:
92710027-92710027
CCATTTTTTTAintergenicDe novo--Yuen2017 G
CCSER1     2-1138-003chr4:
92303434-92303434
CTintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     2-1627-003chr4:
92895208-92895208
CAintergenicDe novo--Yuen2017 G
CCSER1     AU046706chr4:
91996645-91996645
TCintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU3517302chr4:
92870267-92870267
GAintergenicDe novo--Yuen2017 G
CCSER1     2-0028-003chr4:
91575869-91575869
TAintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU4246304chr4:
91824258-91824258
GAintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     2-1455-003chr4:
92158027-92158027
TCintronicDe novo--Yuen2017 G
CCSER1     5-0106-003chr4:
91485541-91485541
ATintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU2711303chr4:
92892306-92892306
CTintergenicDe novo--Yuen2017 G
CCSER1     AU3646301chr4:
92488903-92488903
GAintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     2-0297-003chr4:
91676137-91676137
AGintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU3720302chr4:
91536113-91536113
AGintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     AU3720302chr4:
92861750-92861750
TAintergenicDe novo--Yuen2017 G
CCSER1     AU072904chr4:
93108336-93108336
GCintergenicDe novo--Yuen2017 G
CCSER1     2-0307-004chr4:
92893891-92893902
GAGCCAGTTTTTGintergenicDe novo--Yuen2017 G
CCSER1     2-1230-003chr4:
92927702-92927702
TCintergenicDe novo--Yuen2017 G
CCSER1     1-0295-003chr4:
92991826-92991826
CTintergenicDe novo--Yuen2017 G
CCSER1     1-0632-003chr4:
93144460-93144460
TCintergenicDe novo--Yuen2017 G
CCSER1     1-0126-004chr4:
91745925-91745925
GAintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     3-0456-000 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
CCSER1     AU045010chr4:
92789695-92789695
ACintergenicDe novo--Yuen2017 G
CCSER1     1-0841-003chr4:
92849593-92849593
CGintergenicDe novo--Yuen2017 G
CCSER1     iHART2410chr4:
91229448-91229448
GTexonicPaternalstopgainNM_001145065
NM_207491
c.G13T
c.G13T
p.G5X
p.G5X
38.0-Ruzzo2019 G
CCSER1     iHART2409chr4:
91229448-91229448
GTexonicPaternalstopgainNM_001145065
NM_207491
c.G13T
c.G13T
p.G5X
p.G5X
38.0-Ruzzo2019 G
CCSER1     1-0141-003chr4:
91231769-91231769
GTintronicDe novo--Trost2022 G
Yuen2017 G
CCSER1     iHART2412chr4:
91229448-91229448
GTexonicPaternalstopgainNM_001145065
NM_207491
c.G13T
c.G13T
p.G5X
p.G5X
38.0-Ruzzo2019 G
CCSER1     iHART2411chr4:
91229448-91229448
GTexonicPaternalstopgainNM_001145065
NM_207491
c.G13T
c.G13T
p.G5X
p.G5X
38.0-Ruzzo2019 G
CCSER1     1-0092-004chr4:
92991400-92991400
CCCATintergenicDe novo--Yuen2017 G
CCSER1     AU4347301chr4:
91761365-91761365
TCintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More