or
or
Exact

Results for "LEPR"

Variant Events: 37

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LEPR     MT_151.3chr1:
65986314-65986314
GGACintronicDe novo--Trost2022 G
LEPR     AU3636301chr1:
65918521-65918521
ATintronicDe novo--Trost2022 G
Yuen2017 G
LEPR     AU3779304chr1:
65967529-65967529
GAintronicDe novo--Trost2022 G
Yuen2017 G
LEPR     7-0390-004chr1:
65942388-65942388
CTintronicDe novo--Trost2022 G
LEPR     1-1212-003chr1:
66019509-66019509
CTintronicDe novo--Trost2022 G
LEPR     5-0053-003chr1:
66000822-66000822
AATGTGTGintronicDe novo--Trost2022 G
LEPR     2-1766-003chr1:
65921596-65921596
GCintronicDe novo--Trost2022 G
LEPR     5-0033-004chr1:
65911477-65911477
AACAACintronicDe novo--Trost2022 G
LEPR     SJD_10.3chr1:
65928525-65928525
GCintronicDe novo--Trost2022 G
LEPR     A21chr1:
65949692-65949692
GTintronicDe novo--Wu2018 G
LEPR     REACH000558chr1:
65926050-65926050
GAintronicDe novo--Trost2022 G
LEPR     AU3853302chr1:
66073851-66073851
CTintronicDe novo--Trost2022 G
LEPR     1-1217-003chr1:
66046325-66046325
CTintronicDe novo--Trost2022 G
LEPR     2-1174-005Bchr1:
66239520-66239520
ACintergenicDe novo--Yuen2017 G
LEPR     7-0307-003chr1:
66082476-66082476
TTAintronicDe novo--Trost2022 G
LEPR     REACH000198chr1:
66079479-66079479
CAintronicDe novo--Trost2022 G
LEPR     SP0049978chr1:
66037986-66037986
TGintronicDe novo-5.0E-4Trost2022 G
LEPR     MSSNG00031-003chr1:
66031320-66031320
CAintronicDe novo--Trost2022 G
LEPR     11368.p1chr1:
65886488-65886489
TGTintronicDe novo--Iossifov2014 E
Kosmicki2017 E
LEPR     SP0118407chr1:
66037986-66037986
TGintronicDe novo-5.0E-4Trost2022 G
LEPR     SP0077003chr1:
66037986-66037986
TGintronicDe novo-5.0E-4Trost2022 G
LEPR     5-0017-003chr1:
66067614-66067614
GAexonicDe novosynonymous SNVNM_001198687
NM_001198688
NM_001198689
NM_001003679
NM_001003680
NM_002303
c.G1374A
c.G1374A
c.G1374A
c.G1374A
c.G1374A
c.G1374A
p.A458A
p.A458A
p.A458A
p.A458A
p.A458A
p.A458A
-2.472E-5Trost2022 G
Yuen2017 G
Zhou2022 GE
LEPR     AU3052301chr1:
66063182-66063182
GAintronicDe novo--Trost2022 G
Yuen2017 G
LEPR     74-0265chr1:
66077434-66077434
GTintronicDe novo--Michaelson2012 G
LEPR     2-1632-003chr1:
66184918-66184932
ACCTCTCCTCTCCTCACCTCTCCTCintergenicDe novo--Yuen2017 G
LEPR     AU2140306chr1:
66093376-66093376
TCintronicDe novo--Trost2022 G
Yuen2017 G
LEPR     1-0121-003chr1:
65940029-65940029
AGintronicDe novo--Trost2022 G
Yuen2017 G
LEPR     14339.p1chr1:
65909123-65909123
AAATintronicUnknown--Werling2018 G
LEPR     2-0012-003chr1:
65929486-65929486
TCintronicDe novo--Yuen2017 G
LEPR     A30chr1:
65973375-65973375
GAintronicDe novo--Wu2018 G
LEPR     7-0251-003chr1:
65951294-65951310
ACTCTCTCTCTCTCTCTACTCTCTCTCTCTCTintronicDe novo--Yuen2017 G
LEPR     2-1561-003chr1:
66219479-66219481
ATTAintergenicDe novo--Yuen2017 G
LEPR     1-1210-003chr1:
65905909-65905909
TCintronicDe novo--Trost2022 G
LEPR     2-1659-003chr1:
65896425-65896425
AAACAACTGCTACTTGintronicDe novo--Trost2022 G
LEPR     2-1619-004chr1:
65911471-65911474
AGACTTCTTCTATATTAATintronicDe novo--Trost2022 G
LEPR     5-0033-004chr1:
65911471-65911474
AGACTTCTTCTATATTAATintronicDe novo--Trost2022 G
LEPR     mAGRE4268chr1:
66074585-66074585
GAsplicingPaternalsplicing23.9-Cirnigliaro2023 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More