
Results for "LRP12"

Variant Events: 80

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
LRP12     5-0109-003chr8:
LRP12     1-0520-003chr8:
CAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LRP12     AU2756306 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
LRP12     74-0265chr8:
AGintergenicDe novo--Michaelson2012 G
LRP12     2-1355-004chr8:
CTintergenicDe novo--Yuen2017 G
LRP12     12795.p1chr8:
TCintergenicDe novo--Turner2016 G
LRP12     1-0339-004chr8:
TCintergenicDe novo--Yuen2017 G
LRP12     1-0274-003chr8:
GAintergenicDe novo--Yuen2017 G
LRP12     1-0564-003chr8:
GCintergenicDe novo--Yuen2017 G
LRP12     AU4150301chr8:
CTintergenicDe novo--Yuen2017 G
LRP12     AU2950301chr8:
ATTTTTTTATTTTTTTTintergenicDe novo--Yuen2017 G
LRP12     7-0192-003chr8:
GAintergenicDe novo--Yuen2017 G
LRP12     AU3053301chr8:
ATintergenicDe novo--Yuen2017 G
LRP12     mAGRE1205chr8:
39.0-Cirnigliaro2023 G
LRP12     2-1348-003chr8:
GAintergenicDe novo--Yuen2017 G
LRP12     AU3702306chr8:
TCintergenicDe novo--Yuen2017 G
LRP12     1-0539-003chr8:
GAintergenicDe novo--Yuen2017 G
LRP12     AU3918302chr8:
TGintergenicDe novo--Yuen2017 G
LRP12     AU4483301chr8:
TCintergenicDe novo--Yuen2017 G
LRP12     2-1291-003chr8:
GTintergenicDe novo--Yuen2017 G
LRP12     2-1373-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
LRP12     5-0025-003chr8:
CCAGCTGATCTAintergenicDe novo--Yuen2017 G
LRP12     AU060004chr8:
GTintergenicDe novo--Yuen2017 G
LRP12     1-0524-003chr8:
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
LRP12     2-0127-004chr8:
GAintergenicDe novo--Yuen2017 G
LRP12     AU3646301chr8:
AGintergenicDe novo--Yuen2017 G
LRP12     1-0150-003chr8:
CGintergenicDe novo--Yuen2017 G
LRP12     2-1402-003chr8:
GAintergenicDe novo--Yuen2017 G
LRP12     AU3302302chr8:
GCintergenicDe novo--Yuen2017 G
LRP12     1-0372-003chr8:
AGintronicDe novo--Yuen2016 G
Yuen2017 G
LRP12     AU3302302chr8:
GAintergenicDe novo--Yuen2017 G
LRP12     1-0443-003chr8:
AGintergenicDe novo--Yuen2016 G
LRP12     4-0043-003chr8:
AGintronicDe novo--Trost2022 G
LRP12     NDAR_INVJM256MXY_wes1chr8:
AGintronicDe novo-0.0056Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
LRP12     iHART1205chr8:
39.0-Ruzzo2019 G
LRP12     MSSNG00367-004chr8:
TCintronicDe novo--Trost2022 G
LRP12     1-0372-003chr8:
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
LRP12     5-0030-003chr8:
GATAAAACAGATAAAACTTAGintronicDe novo--Trost2022 G
LRP12     1-0299-004chr8:
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRP12     2-1440-003chr8:
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
LRP12     MSSNG00354-004chr8:
TCintronicDe novo--Trost2022 G
LRP12     2-1085-004chr8:
TCintergenicDe novo--Yuen2017 G
LRP12     AU055603chr8:
TCUTR3De novo--Trost2022 G
LRP12     REACH000731chr8:
ACintronicDe novo--Trost2022 G
LRP12     2-1209-003chr8:
TCdownstreamDe novo--Trost2022 G
LRP12     AU4089301chr8:
TGintergenicDe novo--Yuen2017 G
LRP12     AU2463301chr8:
GAintronicDe novo--Trost2022 G
LRP12     AU4089301chr8:
GAintergenicDe novo--Yuen2017 G
LRP12     7-0252-003chr8:
GAintronicDe novo--Trost2022 G
LRP12     AU4093304chr8:
CCCATCCCintergenicDe novo--Yuen2017 G
LRP12     10-1104-004chr8:
CTintronicDe novo--Trost2022 G
LRP12     2-1501-003chr8:
ACintergenicDe novo--Yuen2017 G
LRP12     5-0043-003chr8:
ATintronicDe novo--Trost2022 G
LRP12     AU005213chr8:
CAACAintergenicDe novo--Yuen2017 G
LRP12     10C109030chr8:
AGintronicDe novo--Satterstrom2020 E
Trost2022 G
LRP12     2-1788-003chr8:
TCintronicDe novo--Trost2022 G
LRP12     2-0149-004chr8:
AATintergenicDe novo--Yuen2017 G
LRP12     2-1075-003chr8:
ACintronicDe novo--Trost2022 G
LRP12     3-0099-000chr8:
AGintronicDe novo--Trost2022 G
LRP12     AU3124302chr8:
GAintergenicDe novo--Yuen2017 G
LRP12     MSSNG00373-003chr8:
GAintronicDe novo--Trost2022 G
LRP12     AU3839303chr8:
TCintergenicDe novo--Yuen2017 G
LRP12     2-1508-004chr8:
GAintergenicDe novo--Yuen2017 G
LRP12     AU3190305chr8:
ACATCATCAACATCAintergenicDe novo--Yuen2017 G
LRP12     AU2089302chr8:
CGintergenicDe novo--Yuen2017 G
LRP12     AU4013303chr8:
AGintergenicDe novo--Yuen2017 G
LRP12     1-0393-003chr8:
CGintergenicDe novo--Yuen2017 G
LRP12     1-0560-003chr8:
TCintergenicDe novo--Yuen2017 G
LRP12     AU1725306chr8:
TCintergenicDe novo--Yuen2017 G
LRP12     2-1579-003chr8:
GTintergenicDe novo--Yuen2017 G
LRP12     AU3891303chr8:
ACintergenicDe novo--Yuen2017 G
LRP12     14151.p1chr8:
TTTGintergenicDe novo--Werling2018 G
LRP12     5-0077-003chr8:
TTTTTTTAintergenicDe novo--Yuen2017 G
LRP12     1-0274-004chr8:
GAintergenicDe novo--Yuen2017 G
LRP12     1-0459-004chr8:
GAintergenicDe novo--Yuen2017 G
LRP12     2-1085-003chr8:
TCintergenicDe novo--Yuen2017 G
LRP12     7-0250-003chr8:
TGintergenicDe novo--Yuen2017 G
LRP12     2-1291-003chr8:
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
LRP12     5-0137-003chr8:
CTintergenicDe novo--Yuen2017 G
LRP12     AU4250301chr8:
TCintergenicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView