or
or
Exact

Results for "NAALADL2"

Variant Events: 143

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NAALADL2     AU3399303chr3:
175340517-175340517
TGintronicDe novo--Yuen2017 G
NAALADL2     AU3905302chr3:
175212973-175212973
CAintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     2-1134-003chr3:
176077323-176077323
CGintergenicDe novo--Yuen2017 G
NAALADL2     2-1134-003chr3:
174944880-174944880
GAintronicDe novo--Yuen2017 G
NAALADL2     1-0914-003chr3:
174690678-174690678
CTintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     2-1163-003chr3:
175407530-175407530
ACintronicDe novo--Yuen2016 G
Yuen2017 G
NAALADL2     2-0296-003chr3:
174795522-174795522
GCintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     2-1361-003chr3:
175322243-175322243
CGintronicDe novo--Yuen2017 G
NAALADL2     AU3881302chr3:
175266088-175266088
AGintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     AU3903302chr3:
176130194-176130194
CTintergenicDe novo--Yuen2017 G
NAALADL2     1-0125-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
NAALADL2     Viggiano2022:22.4chr3:
174814885-174814885
AGexonicPaternalnonsynonymous SNVNM_207015c.A349Gp.S117G10.698.293E-6Viggiano2022 GT
NAALADL2     Viggiano2022:22.3chr3:
174814885-174814885
AGexonicPaternalnonsynonymous SNVNM_207015c.A349Gp.S117G10.698.293E-6Viggiano2022 GT
NAALADL2     2-1317-003chr3:
175233348-175233348
GAintronicDe novo--Yuen2017 G
NAALADL2     2-1317-003chr3:
175232717-175232717
CAintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     AU3849302chr3:
174945631-174945631
CTintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     1-0547-003chr3:
175522565-175522565
TGUTR3De novo--Trost2022 G
Yuen2017 G
NAALADL2     1-0203-003chr3:
175059724-175059724
CGintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     mAGRE2131chr3:
174814870-174814870
CTexonicPaternalstopgainNM_207015c.C334Tp.R112X20.74.0E-4Cirnigliaro2023 G
NAALADL2     AU3874303chr3:
175022072-175022072
ACintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     5-0003-003chr3:
174742350-174742350
GCintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     5-0015-004chr3:
175687845-175687845
TGintergenicDe novo--Yuen2017 G
NAALADL2     1-0171-005chr3:
175833317-175833317
GAintergenicDe novo--Yuen2017 G
NAALADL2     1-0171-005chr3:
175572066-175572066
CTintergenicDe novo--Yuen2017 G
NAALADL2     74-0355chr3:
174935513-174935513
GAintronicDe novo--Michaelson2012 G
NAALADL2     2-1242-003chr3:
174757774-174757774
TGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
NAALADL2     AU072505chr3:
174594952-174594952
GCintronicDe novo--Yuen2017 G
NAALADL2     AU1742302chr3:
174743828-174743828
TCintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     2-1137-003chr3:
175739327-175739327
GAintergenicDe novo--Yuen2017 G
NAALADL2     7-0130-003chr3:
175585914-175585916
CTACintergenicDe novo--Yuen2017 G
NAALADL2     2-0242-003chr3:
174789011-174789011
CTintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     MSSNG00016-003chr3:
174614791-174614791
ACintronicDe novo--Trost2022 G
NAALADL2     2-1787-003chr3:
174628707-174628707
CTintronicDe novo--Trost2022 G
NAALADL2     AU023012chr3:
174606737-174606737
TCintronicDe novo--Trost2022 G
NAALADL2     2-1167-003chr3:
175166595-175166595
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
NAALADL2     REACH000454chr3:
174613172-174613172
TCintronicDe novo--Trost2022 G
NAALADL2     2-1086-004chr3:
175614313-175614313
AGintergenicDe novo--Yuen2017 G
NAALADL2     AU023012chr3:
174605201-174605201
TCintronicDe novo--Trost2022 G
NAALADL2     AU023012chr3:
174606195-174606195
TGintronicDe novo--Trost2022 G
NAALADL2     MSSNG00041-003chr3:
174600334-174600336
CATCintronicDe novo--Trost2022 G
NAALADL2     1-0262-003Achr3:
174749258-174749258
CTintronicDe novo--Trost2022 G
NAALADL2     2-1373-003chr3:
176012154-176012154
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
NAALADL2     3-0070-000chr3:
174753768-174753768
GCintronicDe novo--Trost2022 G
NAALADL2     AU2333302chr3:
175448492-175448492
AGintronicDe novo--Yuen2017 G
NAALADL2     4-0073-003chr3:
174664934-174664935
TGATintronicDe novo--Trost2022 G
NAALADL2     3-0376-000chr3:
174697099-174697099
TTCintronicDe novo--Trost2022 G
NAALADL2     MSSNG00162-003chr3:
174654022-174654022
GCintronicDe novo--Trost2022 G
NAALADL2     4-0062-003chr3:
174664934-174664935
TGATintronicDe novo--Trost2022 G
NAALADL2     AU4006302chr3:
175434378-175434378
TCintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     5-5015-003chr3:
174640938-174640938
AGintronicDe novo--Trost2022 G
NAALADL2     REACH000073chr3:
174644331-174644331
GAintronicDe novo--Trost2022 G
NAALADL2     2-1169-003chr3:
174950630-174950636
GCCCCAAAGGTATCTTCTTAGGintronicDe novo--Trost2022 G
NAALADL2     MSSNG00218-003chr3:
174952626-174952626
CTintronicDe novo--Trost2022 G
NAALADL2     MSSNG00111-004chr3:
174869484-174869484
GAintronicDe novo--Trost2022 G
NAALADL2     AU2310301chr3:
174912002-174912002
TGintronicDe novo--Trost2022 G
NAALADL2     AU0452304chr3:
176155981-176155983
TCCTCintergenicDe novo--Yuen2017 G
NAALADL2     AU2320301chr3:
174862014-174862014
ACintronicDe novo--Trost2022 G
NAALADL2     REACH000092chr3:
174862632-174862632
ATintronicDe novo--Trost2022 G
NAALADL2     2-1223-003chr3:
175756438-175756438
TCintergenicDe novo--Yuen2017 G
NAALADL2     3-0460-000chr3:
175092561-175092561
CAintronicDe novo--Trost2022 G
NAALADL2     10-1129-005chr3:
175111242-175111242
TCintronicDe novo--Trost2022 G
NAALADL2     2-1222-003chr3:
176006157-176006157
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
NAALADL2     2-1198-003chr3:
175068538-175068538
ACintronicDe novo--Trost2022 G
NAALADL2     7-0024-003chr3:
176143318-176143318
TCintergenicDe novo--Yuen2017 G
NAALADL2     MSSNG00035-004chr3:
175069271-175069271
CTintronicDe novo--Trost2022 G
NAALADL2     MSSNG00073-003chr3:
175030482-175030482
CTintronicDe novo--Trost2022 G
NAALADL2     1-1058-004chr3:
175035978-175035978
GAintronicDe novo--Trost2022 G
NAALADL2     1-0153-005Achr3:
175007567-175007571
TAGAGTintronicDe novo--Trost2022 G
NAALADL2     7-0286-003Achr3:
175255860-175255860
CTintronicDe novo--Trost2022 G
NAALADL2     13298.p1chr3:
175234916-175234916
TCintronicDe novo--Turner2016 G
NAALADL2     2-1251-003chr3:
175329649-175329649
CTintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     REACH000229chr3:
175277733-175277733
GAintronicDe novo--Trost2022 G
NAALADL2     2-0238-003chr3:
174597797-174597797
TAintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     1-1034-003chr3:
175180109-175180109
GTintronicDe novo--Trost2022 G
NAALADL2     MT_186.4chr3:
175213523-175213523
CAintronicDe novo--Trost2022 G
NAALADL2     1-0201-004chr3:
174656371-174656371
GCintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     12795.p1chr3:
175306471-175306471
TCintronicDe novo--Turner2016 G
NAALADL2     AU2437302chr3:
175521182-175521182
TAUTR3De novo--Trost2022 G
Yuen2017 G
NAALADL2     AU2218301chr3:
175132882-175132882
AGintronicDe novo--Trost2022 G
NAALADL2     12795.p1chr3:
175306475-175306475
TCintronicDe novo--Turner2016 G
NAALADL2     2-0070-003chr3:
175245689-175245689
ATintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     1-0683-004chr3:
174767939-174767939
GCintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     2-1290-003chr3:
176143318-176143318
TCintergenicDe novo--Yuen2017 G
NAALADL2     REACH000224chr3:
175416125-175416125
ATintronicDe novo--Trost2022 G
NAALADL2     4-0002-003chr3:
175416233-175416233
AGintronicDe novo--Trost2022 G
NAALADL2     AU1448303chr3:
175406894-175406900
ATATAAGAintronicDe novo--Trost2022 G
NAALADL2     MSSNG00044-004chr3:
175416079-175416079
AGintronicDe novo--Trost2022 G
NAALADL2     AU2461301chr3:
175332183-175332183
TCintronicDe novo--Trost2022 G
NAALADL2     AU1448303chr3:
175398136-175398136
GTintronicDe novo--Trost2022 G
NAALADL2     MT_58.3chr3:
175287222-175287222
GCintronicDe novo--Trost2022 G
NAALADL2     1-0753-003chr3:
175299198-175299198
CAintronicDe novo--Trost2022 G
NAALADL2     7-0354-005chr3:
175521188-175521188
TGUTR3De novo--Trost2022 G
NAALADL2     REACH000345chr3:
175512740-175512740
TGintronicDe novo--Trost2022 G
NAALADL2     5-2005-003chr3:
175514949-175514949
AGintronicDe novo--Trost2022 G
NAALADL2     MSSNG00362-003chr3:
175504811-175504811
TCintronicDe novo--Trost2022 G
NAALADL2     MSSNG00362-003chr3:
175504814-175504814
TGintronicDe novo--Trost2022 G
NAALADL2     MSSNG00109-004chr3:
175439704-175439704
CTintronicDe novo--Trost2022 G
NAALADL2     2-1244-003chr3:
175373700-175373700
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
NAALADL2     AU2764301chr3:
175466777-175466777
TCintronicDe novo--Trost2022 G
NAALADL2     2-1362-004chr3:
176168670-176168670
TCintergenicDe novo--Yuen2017 G
NAALADL2     7-0191-003chr3:
175108106-175108106
TAintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     AU4273304chr3:
175748113-175748113
TGintergenicDe novo--Yuen2017 G
NAALADL2     1-0936-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
NAALADL2     1-0024-003chr3:
175974417-175974417
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NAALADL2     2-1189-003chr3:
175020911-175020911
GAintronicDe novo--Yuen2016 G
Yuen2017 G
NAALADL2     1-0112-004chr3:
175048690-175048690
TCintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     2-0003-003chr3:
175596550-175596552
CATCintergenicDe novo--Yuen2017 G
NAALADL2     1-0595-005chr3:
176143370-176143370
TCintergenicDe novo--Yuen2017 G
NAALADL2     AU2787302chr3:
175397487-175397487
GAintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     2-1567-003chr3:
175980512-175980512
TCintergenicDe novo--Yuen2017 G
NAALADL2     1-0973-003chr3:
175870895-175870895
AGintergenicDe novo--Yuen2017 G
NAALADL2     AU4067301chr3:
175977081-175977081
ACintergenicDe novo--Yuen2017 G
NAALADL2     AU072904chr3:
174838719-174838719
CTintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     2-1383-003chr3:
175903526-175903534
ACAGTCAGTACAGTintergenicDe novo--Yuen2017 G
NAALADL2     12460.p1chr3:
175033923-175033923
ACintronicDe novo--Werling2018 G
NAALADL2     2-1456-003chr3:
176143220-176143220
TCintergenicDe novo--Yuen2017 G
NAALADL2     2-0012-003chr3:
175095511-175095511
GAintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     AU3635301chr3:
175959649-175959649
TCintergenicDe novo--Yuen2017 G
NAALADL2     1-0295-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
NAALADL2     1-0153-005chr3:
175007567-175007571
TAGAGTintronicDe novo--Yuen2017 G
NAALADL2     1-0455-003chr3:
174794263-174794263
CTintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     AU071203chr3:
174734968-174734968
TCintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     1-0632-003chr3:
175933490-175933490
GCintergenicDe novo--Yuen2017 G
NAALADL2     1-0191-003chr3:
176143370-176143370
TCintergenicDe novo--Yuen2017 G
NAALADL2     1-0652-003chr3:
176092891-176092891
CTintergenicDe novo--Yuen2017 G
NAALADL2     2-1215-003chr3:
175508970-175508970
GCintronicDe novo--Yuen2017 G
NAALADL2     AU4056302chr3:
175566214-175566214
TCintergenicDe novo--Yuen2017 G
NAALADL2     SP0080381chr3:
175345086-175345086
GAexonicDe novononsynonymous SNVNM_207015c.G1808Ap.S603N13.85-Fu2022 E
Trost2022 G
Zhou2022 GE
NAALADL2     2-1497-003chr3:
175054741-175054741
GAintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     SP0115411chr3:
175165085-175165085
GAexonicDe novononsynonymous SNVNM_207015c.G1159Ap.V387I4.6934.872E-5Fu2022 E
Zhou2022 GE
NAALADL2     1-0324-003chr3:
175438515-175438515
CTintronicDe novo--Yuen2017 G
NAALADL2     1-0286-004chr3:
175206069-175206069
CGintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     AU3997302chr3:
174712652-174712652
TCintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     2-1391-004chr3:
175570335-175570338
TACCTintergenicDe novo--Yuen2017 G
NAALADL2     1-0412-003chr3:
176143382-176143382
GCintergenicDe novo--Yuen2017 G
NAALADL2     2-1176-003chr3:
176045148-176045148
GAintergenicDe novo--Yuen2017 G
NAALADL2     1-0402-004chr3:
174584261-174584261
AGintronicDe novo--Yuen2017 G
NAALADL2     2-1176-003chr3:
175541631-175541631
TCintergenicDe novo--Yuen2017 G
NAALADL2     2-1277-003chr3:
174747389-174747389
ATintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     AU072004chr3:
175959102-175959102
ACintergenicDe novo--Yuen2017 G
NAALADL2     1-0196-005chr3:
174877440-174877440
AGintronicDe novo--Trost2022 G
Yuen2017 G
NAALADL2     2-1089-004chr3:
176143394-176143394
TCintergenicDe novo--Yuen2017 G
NAALADL2     2-0135-003chr3:
176143318-176143318
TCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More