or
or
Exact

Results for "CADM2"

Variant Events: 151

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CADM2     2-1734-003chr3:
86294829-86294829
TCintergenicDe novo--Yuen2017 G
CADM2     AU3905302chr3:
86238127-86238127
CAintergenicDe novo--Yuen2017 G
CADM2     1-0218-003chr3:
85576862-85576862
AGintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     1-0045-003chr3:
86600746-86600746
CTintergenicDe novo--Yuen2017 G
CADM2     AU018010chr3:
86905862-86905862
CGintergenicDe novo--Yuen2017 G
CADM2     1-0352-005chr3:
86363801-86363801
AGintergenicDe novo--Yuen2017 G
CADM2     14482.p1chr3:
86117978-86117978
CTUTR3De novo--Turner2016 G
CADM2     1-0041-003chr3:
86723624-86723624
TCintergenicDe novo--Yuen2017 G
CADM2     11002.p1chr3:
85338945-85338945
AGintronicDe novo--Turner2016 G
CADM2     14590.p1chr3:
85628149-85628149
GAintronicDe novo--Turner2016 G
CADM2     AU3912301chr3:
86249155-86249155
CAintergenicDe novo--Yuen2017 G
CADM2     AU1687302chr3:
86721880-86721880
TAintergenicDe novo--Yuen2017 G
CADM2     1-0563-004chr3:
85781294-85781294
CTintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     7-0002-003chr3:
86128508-86128508
CTintergenicDe novo--Yuen2017 G
CADM2     AU065304chr3:
85356916-85356916
AGintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     5-0131-003chr3:
85878437-85878437
CTintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     AU038204chr3:
86979541-86979544
GTCTGTCTCTintergenicDe novo--Yuen2017 G
CADM2     AU4067303chr3:
86177371-86177372
TATAAintergenicDe novo--Yuen2017 G
CADM2     1-0080-003chr3:
86576650-86576650
TCintergenicDe novo--Yuen2017 G
CADM2     2-1430-003chr3:
86139681-86139681
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
CADM2     2-1501-003chr3:
85983934-85983934
AGintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     2-1562-004chr3:
85082013-85082013
AGintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     2-0319-004chr3:
86572381-86572381
TCintergenicDe novo--Yuen2017 G
CADM2     AU058105chr3:
86080555-86080555
TGintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     1-0701-003chr3:
86586965-86586965
AGintergenicDe novo--Yuen2017 G
CADM2     AU4033304chr3:
85992806-85992806
AGintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     AU4315302chr3:
86637707-86637707
GTintergenicDe novo--Yuen2017 G
CADM2     2-1093-003chr3:
86267892-86267892
GAintergenicDe novo--Yuen2017 G
CADM2     12445.p1chr3:
85258815-85258815
TTAintronicDe novo--Werling2018 G
CADM2     7-0055-003chr3:
85764258-85764259
ACAintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     3-0065-000chr3:
86054427-86054427
CTintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     AU3787303chr3:
86890883-86890883
GAintergenicDe novo--Yuen2017 G
CADM2     1-0715-003chr3:
86722891-86722891
ATintergenicDe novo--Yuen2017 G
CADM2     2-1245-003chr3:
85980615-85980615
TCintronicDe novo--Yuen2017 G
CADM2     AU3692301chr3:
85519144-85519144
CTintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     2-1325-003chr3:
85423894-85423894
ACintronicDe novo--Yuen2016 G
Yuen2017 G
CADM2     2-0242-003chr3:
85901340-85901340
TCintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     2-1357-003chr3:
86617036-86617036
CTintergenicDe novo--Yuen2017 G
CADM2     AU073003chr3:
85580258-85580258
CTintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     AU1687303chr3:
86721880-86721880
TAintergenicDe novo--Yuen2017 G
CADM2     1-0007-003chr3:
85019082-85019082
GAintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     AU3052302chr3:
85726583-85726583
ATintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     1-0197-003chr3:
85482625-85482625
GAintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     1-0567-004chr3:
86268210-86268210
GCintergenicDe novo--Yuen2017 G
CADM2     2-1129-003chr3:
85460379-85460379
TCintronicDe novo--Yuen2016 G
Yuen2017 G
CADM2     1-0552-003chr3:
86943179-86943185
GCTGTCTGCTintergenicDe novo--Yuen2017 G
CADM2     1-0352-003chr3:
86363801-86363801
AGintergenicDe novo--Yuen2016 G
CADM2     AU050704chr3:
85052848-85052848
GAintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     AU061003chr3:
85348332-85348332
CAintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     AU065807chr3:
85372030-85372030
GAintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     2-0264-004chr3:
86916804-86916804
TCintergenicDe novo--Yuen2017 G
CADM2     AU4188302chr3:
85894740-85894740
CGintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     2-1480-003chr3:
86244088-86244088
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
CADM2     AU047904chr3:
86562694-86562694
AGintergenicDe novo--Yuen2017 G
CADM2     AU3857301chr3:
85127774-85127774
AGintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     2-1264-003chr3:
86180387-86180387
GCintergenicDe novo--Yuen2017 G
CADM2     SP0001111chr3:
86115818-86115818
CAexonicDe novononsynonymous SNVNM_001167674
NM_001167675
NM_001256503
NM_001256505
NM_153184
NM_001256502
NM_001256504
c.C1193A
c.C1100A
c.C869A
c.C749A
c.C1199A
c.C869A
c.C749A
p.T398K
p.T367K
p.T290K
p.T250K
p.T400K
p.T290K
p.T250K
21.0-Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
CADM2     AU4246304chr3:
85551526-85551526
GAintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     AU1668302chr3:
86670113-86670113
GAintergenicDe novo--Yuen2017 G
CADM2     AU1542303chr3:
86861636-86861636
GAintergenicDe novo--Yuen2017 G
CADM2     1-0104-003chr3:
85269171-85269171
GGTGTATTTGTintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     1-0079-003chr3:
86496311-86496311
CTintergenicDe novo--Yuen2017 G
CADM2     AU031204chr3:
85165111-85165111
TCintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     A16chr3:
85927127-85927127
AGintronicDe novo--Wu2018 G
CADM2     5-0017-003chr3:
86460379-86460383
ATTGTAintergenicDe novo--Yuen2017 G
CADM2     2-1089-003chr3:
86705066-86705066
GAintergenicDe novo--Yuen2017 G
CADM2     7-0171-003chr3:
85568481-85568481
CTintronicDe novo--Yuen2017 G
CADM2     1-0402-003chr3:
86767825-86767825
TCintergenicDe novo--Yuen2017 G
CADM2     2-1408-004chr3:
86458826-86458826
AGintergenicDe novo--Yuen2017 G
CADM2     AU2577301chr3:
85075742-85075742
TCintronicDe novo--Trost2022 G
CADM2     2-0149-005chr3:
85950687-85950687
GAintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     2-1821-003chr3:
85222403-85222403
GAintronicDe novo--Trost2022 G
CADM2     3-0080-000chr3:
86203147-86203147
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
CADM2     MSSNG00239-003chr3:
85264681-85264682
GTGintronicDe novo--Trost2022 G
CADM2     EGAN00001101164chr3:
86115865-86115865
GAexonicDe novononsynonymous SNVNM_001167674
NM_001167675
NM_001256503
NM_001256505
NM_153184
NM_001256502
NM_001256504
c.G1240A
c.G1147A
c.G916A
c.G796A
c.G1246A
c.G916A
c.G796A
p.D414N
p.D383N
p.D306N
p.D266N
p.D416N
p.D306N
p.D266N
23.8-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
CADM2     SP0064355chr3:
85935445-85935445
TCexonicDe novononsynonymous SNVNM_001167674
NM_001256503
NM_153184
NM_001167675
NM_001256502
NM_001256505
NM_001256504
c.T470C
c.T146C
c.T476C
c.T497C
c.T146C
c.T146C
c.T146C
p.I157T
p.I49T
p.I159T
p.I166T
p.I49T
p.I49T
p.I49T
23.1-Fu2022 E
Trost2022 G
Zhou2022 GE
CADM2     MT_188.3chr3:
85137376-85137376
CTintronicDe novo--Trost2022 G
CADM2     2-1751-003chr3:
85208949-85208949
CTintronicDe novo--Trost2022 G
CADM2     5-0061-003chr3:
86286745-86286745
CTintergenicDe novo--Yuen2017 G
CADM2     2-1362-004chr3:
85119379-85119379
CTintronicDe novo--Trost2022 G
CADM2     2-1629-003chr3:
86436992-86436992
CTintergenicDe novo--Yuen2017 G
CADM2     1-0760-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
Trost2022 G
CADM2     AU004403chr3:
85106428-85106430
TCATintronicDe novo--Trost2022 G
CADM2     MSSNG00359-004chr3:
85115768-85115768
GCintronicDe novo--Trost2022 G
CADM2     1-1025-003chr3:
85431721-85431721
CTintronicDe novo--Trost2022 G
CADM2     3-0847-000chr3:
85462590-85462590
TAintronicDe novo--Trost2022 G
CADM2     1-0279-004chr3:
86954565-86954565
AGintergenicDe novo--Yuen2017 G
CADM2     4-0056-003chr3:
85418767-85418767
AGintronicDe novo--Trost2022 G
CADM2     MSSNG00203-003chr3:
85429581-85429581
GTintronicDe novo--Trost2022 G
CADM2     1-0161-004chr3:
86549948-86549948
TCintergenicDe novo--Yuen2017 G
CADM2     MSSNG00026-004chr3:
85352385-85352385
ATintronicDe novo--Trost2022 G
CADM2     REACH000387chr3:
85364787-85364787
CAintronicDe novo--Trost2022 G
CADM2     1-0294-003chr3:
86357250-86357250
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
CADM2     1-1116-003chr3:
85305379-85305379
CGintronicDe novo--Trost2022 G
CADM2     MT_61.3chr3:
85314619-85314619
GAintronicDe novo--Trost2022 G
CADM2     4-0095-003chr3:
85565832-85565832
CTintronicDe novo--Trost2022 G
CADM2     3-0774-000Achr3:
85573200-85573200
CGintronicDe novo--Trost2022 G
CADM2     AU2320301chr3:
85524190-85524190
ATintronicDe novo--Trost2022 G
CADM2     MSSNG00380-003chr3:
85554193-85554193
CGintronicDe novo--Trost2022 G
CADM2     MT_192.3chr3:
85495294-85495294
GAintronicDe novo--Trost2022 G
CADM2     REACH000089chr3:
85511906-85511906
AGintronicDe novo--Trost2022 G
CADM2     MSSNG00032-004chr3:
85483125-85483125
TGintronicDe novo--Trost2022 G
CADM2     1-0514-003chr3:
85205301-85205301
CGintronicDe novo--Yuen2017 G
CADM2     AU2310301chr3:
85487713-85487713
ACintronicDe novo--Trost2022 G
CADM2     5-0009-003chr3:
85620502-85620502
GCintronicDe novo--Trost2022 G
CADM2     1-0581-003chr3:
85672765-85672765
GCintronicDe novo--Trost2022 G
CADM2     MSSNG00023-003chr3:
85589900-85589900
CTintronicDe novo--Trost2022 G
CADM2     AU3051303chr3:
86872109-86872109
ATintergenicDe novo--Yuen2017 G
CADM2     2-1519-003chr3:
85597411-85597412
CCTTintronicDe novo--Trost2022 G
CADM2     3-0368-000chr3:
85580907-85580907
TCintronicDe novo--Trost2022 G
CADM2     AU4378301chr3:
85325784-85325784
GAintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     AU2320301chr3:
85581691-85581691
CTintronicDe novo--Trost2022 G
CADM2     3-0530-000chr3:
85576061-85576061
TAintronicDe novo--Trost2022 G
CADM2     MSSNG00421-009chr3:
85576884-85576887
AAGCAintronicDe novo--Trost2022 G
CADM2     2-0323-003chr3:
86301444-86301444
GTintergenicDe novo--Yuen2017 G
CADM2     3-0663-000chr3:
85772334-85772334
CTintronicDe novo--Trost2022 G
CADM2     3-0175-000chr3:
85780792-85780792
AGintronicDe novo--Trost2022 G
CADM2     2-1215-003chr3:
86616137-86616137
AGintergenicDe novo--Yuen2017 G
CADM2     MSSNG00024-004chr3:
85719025-85719025
GAintronicDe novo--Trost2022 G
CADM2     1-0565-003chr3:
85485964-85485964
CTintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     2-1215-003chr3:
86160457-86160475
CTGTTCTCCTGGTAGTGAACintergenicDe novo--Yuen2017 G
CADM2     AU2186301chr3:
85743205-85743205
CAintronicDe novo--Trost2022 G
CADM2     MSSNG00364-004chr3:
85693813-85693813
CTintronicDe novo--Trost2022 G
CADM2     AU2310301chr3:
85711183-85711183
TCintronicDe novo--Trost2022 G
CADM2     1-0652-003chr3:
85413212-85413212
TCintronicDe novo--Trost2022 G
Yuen2017 G
CADM2     4-0062-003chr3:
85687150-85687151
CTTAintronicDe novo--Trost2022 G
CADM2     4-0073-003chr3:
85687150-85687151
CTTAintronicDe novo--Trost2022 G
CADM2     AU2756306chr3:
86240309-86240309
AGintergenicDe novo--Yuen2017 G
CADM2     1-0253-004chr3:
86138045-86138045
GAintergenicDe novo--Yuen2017 G
CADM2     5-0123-003chr3:
86688072-86688072
GAintergenicDe novo--Yuen2017 G
CADM2     SJD_22.3chr3:
85832692-85832692
GAintronicDe novo--Trost2022 G
CADM2     4-0096-003chr3:
85840486-85840486
GTintronicDe novo--Trost2022 G
CADM2     MSSNG00437-004chr3:
85792557-85792557
CGintronicDe novo--Trost2022 G
CADM2     4-0034-003chr3:
85795854-85795854
CAintronicDe novo--Trost2022 G
CADM2     1-1159-003chr3:
86016792-86016792
TCintronicDe novo--Trost2022 G
CADM2     MSSNG00362-004chr3:
86028695-86028695
TCintronicDe novo--Trost2022 G
CADM2     1-0593-003chr3:
85260323-85260340
TTCTCTCTCTCTCTCTCTTTCTCTCTCTCTCTCTintronicDe novo--Yuen2017 G
CADM2     2-0214-003chr3:
85961971-85961971
GTintronicDe novo--Trost2022 G
CADM2     MSSNG00403-003chr3:
85996015-85996015
CAintronicDe novo--Trost2022 G
CADM2     2-1757-003chr3:
85944573-85944573
CTintronicDe novo--Trost2022 G
CADM2     AU059003chr3:
85955287-85955287
ATintronicDe novo--Trost2022 G
CADM2     7-0405-004chr3:
85910858-85910862
ATATTAintronicDe novo--Trost2022 G
CADM2     5-5012-003chr3:
85922827-85922827
ATintronicDe novo--Trost2022 G
CADM2     2-1391-004chr3:
86570713-86570716
CAGGCintergenicDe novo--Yuen2017 G
CADM2     X3N7Y_01chr3:
86104645-86104645
CTintronicDe novo--Trost2022 G
CADM2     3-0645-000chr3:
86121482-86121482
TTTAUTR3De novo--Trost2022 G
CADM2     MSSNG00374-003chr3:
86051892-86051892
CTintronicDe novo--Trost2022 G
CADM2     A1chr3:
86279343-86279343
GAintergenicDe novo--Wu2018 G
CADM2     1-1191-003chr3:
86080207-86080207
GTintronicDe novo--Trost2022 G
CADM2     2-1230-003chr3:
85562964-85562964
ATintronicDe novo--Yuen2016 G
Yuen2017 G
CADM2     AU028305chr3:
86799848-86799848
CAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More