or
or
Exact

Results for "TECRL"

Variant Events: 162

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TECRL     5-0055-003chr4:
65245598-65245598
CTintronicDe novo--Trost2022 G
Yuen2017 G
TECRL     7-0100-004chr4:
64378992-64378992
GAintergenicDe novo--Yuen2017 G
TECRL     2-1313-003chr4:
63626393-63626405
AAAACAAACAAACAAAACAAACintergenicDe novo--Yuen2017 G
TECRL     2-1428-003chr4:
65143500-65143500
TAdownstreamDe novo--Yuen2017 G
TECRL     5-0017-004chr4:
63955275-63955275
GAintergenicDe novo--Yuen2017 G
TECRL     AU4496301chr4:
64658722-64658722
CTintergenicDe novo--Yuen2017 G
TECRL     SP0059432chr4:
65180382-65180382
GTexonicDe novononsynonymous SNVNM_001010874c.C535Ap.R179S5.18-Fu2022 E
Trost2022 G
Zhou2022 GE
TECRL     1-0914-003chr4:
65176765-65176765
GAintronicDe novo--Trost2022 G
Yuen2017 G
TECRL     5-0050-004chr4:
64809091-64809098
CCCAGGCACintergenicDe novo--Yuen2017 G
TECRL     2-1438-003chr4:
63711962-63711962
TCintergenicDe novo--Yuen2017 G
TECRL     7-0023-003chr4:
65601379-65601379
TCintergenicDe novo--Yuen2017 G
TECRL     2-1452-003chr4:
64163567-64163567
CGintergenicDe novo--Yuen2017 G
TECRL     1-0352-005chr4:
63578185-63578185
GTintergenicDe novo--Yuen2017 G
TECRL     AU3763305chr4:
63350898-63350898
CTintergenicDe novo--Yuen2017 G
TECRL     2-1339-003chr4:
64719676-64719676
CTintergenicDe novo--Yuen2017 G
TECRL     1-0336-003chr4:
65084214-65084214
TTTAintergenicDe novo--Yuen2017 G
TECRL     2-1242-003chr4:
63626428-63626428
TCintergenicDe novo--Yuen2017 G
TECRL     AU049304chr4:
63602980-63602980
CTintergenicDe novo--Yuen2017 G
TECRL     3-0246-000chr4:
64319112-64319129
AACACACACACACACACAAACACACACACACACAintergenicDe novo--Yuen2017 G
TECRL     AU011021chr4:
64629134-64629134
ATintergenicDe novo--Yuen2017 G
TECRL     AU4024303chr4:
63404222-63404229
AGCAAATGAGintergenicDe novo--Yuen2017 G
TECRL     2-1242-003chr4:
63626464-63626464
ATintergenicDe novo--Yuen2017 G
TECRL     1-0441-003chr4:
65562685-65562685
CTintergenicDe novo--Yuen2016 G
TECRL     2-1456-004chr4:
63383369-63383369
GAintergenicDe novo--Yuen2017 G
TECRL     2-0210-005chr4:
63124345-63124345
AGintergenicDe novo--Yuen2017 G
TECRL     2-1645-003chr4:
65678322-65678322
TCintergenicDe novo--Yuen2017 G
TECRL     AU3912301chr4:
64038827-64038827
CAintergenicDe novo--Yuen2017 G
TECRL     2-0309-004chr4:
63568822-63568822
TCintergenicDe novo--Yuen2017 G
TECRL     AU4173301chr4:
63430749-63430749
AGintergenicDe novo--Yuen2017 G
TECRL     AU076508chr4:
63943338-63943338
AGintergenicDe novo--Yuen2017 G
TECRL     3-0438-000chr4:
64765201-64765201
GTintergenicDe novo--Yuen2016 G
TECRL     AU3175302chr4:
64496193-64496193
ACintergenicDe novo--Yuen2017 G
TECRL     AU3808305chr4:
65065170-65065183
TTTTCTCTTTCTCTTTTTCTCTTTCTCTTTCTCTintergenicDe novo--Yuen2017 G
TECRL     5-0147-003chr4:
65466427-65466427
CGintergenicDe novo--Yuen2017 G
TECRL     2-0256-004chr4:
63481837-63481837
CTintergenicDe novo--Yuen2017 G
TECRL     AU3984302chr4:
65651669-65651669
GCintergenicDe novo--Yuen2017 G
TECRL     1-0054-004chr4:
64349939-64349939
AGintergenicDe novo--Yuen2017 G
TECRL     1-0976-003chr4:
64523442-64523442
TCintergenicDe novo--Yuen2017 G
TECRL     2-1333-003chr4:
65331222-65331222
GAintergenicDe novo--Yuen2017 G
TECRL     2-1112-003chr4:
64215155-64215155
CTintergenicDe novo--Yuen2017 G
TECRL     2-1306-003chr4:
65570018-65570018
CTintergenicDe novo--Yuen2017 G
TECRL     1-0820-003chr4:
63134362-63134362
TCintergenicDe novo--Yuen2017 G
TECRL     2-1436-003chr4:
64378609-64378609
ATintergenicDe novo--Yuen2017 G
TECRL     AU1640302chr4:
64479516-64479516
GTintergenicDe novo--Yuen2017 G
TECRL     1-0674-004chr4:
65678988-65678988
AGintergenicDe novo--Yuen2017 G
TECRL     5-0110-003chr4:
63455952-63455952
TAintergenicDe novo--Yuen2017 G
TECRL     AU2777302chr4:
63186380-63186380
CTintergenicDe novo--Yuen2017 G
TECRL     AU3874303chr4:
63237756-63237756
GAintergenicDe novo--Yuen2017 G
TECRL     AU079104chr4:
64728166-64728166
AGintergenicDe novo--Yuen2017 G
TECRL     AU031203chr4:
64966739-64966739
GTintergenicDe novo--Yuen2017 G
TECRL     1-0554-003chr4:
64649432-64649432
TAintergenicDe novo--Yuen2017 G
TECRL     2-1477-003chr4:
63190031-63190031
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
TECRL     AU072505chr4:
63965289-63965289
ACintergenicDe novo--Yuen2017 G
TECRL     13063.p1chr4:
63918042-63918042
AATintergenicDe novo--Werling2018 G
TECRL     AU1725302chr4:
64626270-64626270
CAintergenicDe novo--Yuen2017 G
TECRL     AU3713301chr4:
65412315-65412315
GCintergenicDe novo--Yuen2017 G
TECRL     5-0041-003chr4:
64916475-64916475
TCintergenicDe novo--Yuen2017 G
TECRL     AU3861303chr4:
63405587-63405587
CAintergenicDe novo--Yuen2017 G
TECRL     1-0384-003chr4:
64106802-64106802
TAintergenicDe novo--Yuen2017 G
TECRL     AU3761301chr4:
64754418-64754418
TCintergenicDe novo--Yuen2017 G
TECRL     1-0344-003chr4:
64045850-64045850
TGintergenicDe novo--Yuen2017 G
TECRL     2-1235-004chr4:
63526980-63526980
GGGAintergenicDe novo--Yuen2017 G
TECRL     2-1738-003chr4:
64431438-64431439
TATACAintergenicDe novo--Yuen2017 G
TECRL     A30chr4:
65449556-65449556
AGintergenicDe novo--Wu2018 G
TECRL     1-0051-004chr4:
65387864-65387864
TCintergenicDe novo--Yuen2017 G
TECRL     1-0051-004chr4:
64535077-64535096
AGAAGTTCTCTGTATTTCCTAintergenicDe novo--Yuen2017 G
TECRL     1-0285-003chr4:
65322959-65322959
CTintergenicDe novo--Yuen2017 G
TECRL     1-0972-003chr4:
64890990-64890990
CAintergenicDe novo--Yuen2017 G
TECRL     AU4197302chr4:
64507711-64507711
CTintergenicDe novo--Yuen2017 G
TECRL     2-0300-004chr4:
64863806-64863806
GTintergenicDe novo--Yuen2017 G
TECRL     AU3782303chr4:
65024302-65024302
TCintergenicDe novo--Yuen2017 G
TECRL     1-0918-003chr4:
65247006-65247006
GTintronicDe novo--Trost2022 G
Yuen2017 G
TECRL     1-0531-003chr4:
65672464-65672464
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
TECRL     AU073003chr4:
64083219-64083219
TCintergenicDe novo--Yuen2017 G
TECRL     AU3891303chr4:
65410712-65410712
ACintergenicDe novo--Yuen2017 G
TECRL     AU4092302chr4:
63249794-63249794
TGintergenicDe novo--Yuen2017 G
TECRL     AU0452304chr4:
63756490-63756490
ATintergenicDe novo--Yuen2017 G
TECRL     2-1646-003chr4:
65636604-65636604
TCintergenicDe novo--Yuen2017 G
TECRL     1-0400-003chr4:
63801907-63801907
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
TECRL     1-0651-003chr4:
63125022-63125022
GAintergenicDe novo--Yuen2017 G
TECRL     1-0496-003chr4:
65168186-65168186
GTintronicDe novo--Yuen2017 G
TECRL     1-0445-003chr4:
63216741-63216741
AGintergenicDe novo--Yuen2017 G
TECRL     1-0552-003chr4:
63612661-63612661
ACintergenicDe novo--Yuen2017 G
TECRL     A11chr4:
64862871-64862871
GCintergenicDe novo--Wu2018 G
TECRL     2-0036-003chr4:
63129824-63129824
TCintergenicDe novo--Yuen2016 G
TECRL     2-1251-003chr4:
65046799-65046822
TTTGTTGTTGTTGTTGTTGTTGTTTTTGTTGTTGTTGTTGTTGTTGTTGTTintergenicDe novo--Yuen2017 G
TECRL     7-0249-003chr4:
64839187-64839187
TGintergenicDe novo--Yuen2017 G
TECRL     5-0099-003chr4:
64397710-64397710
TCintergenicDe novo--Yuen2017 G
TECRL     mAGRE5517chr4:
65188406-65188406
CCGsplicingMaternalsplicing-8.359E-6Cirnigliaro2023 G
TECRL     5-0099-003chr4:
65634619-65634619
CTintergenicDe novo--Yuen2017 G
TECRL     14378.p1chr4:
65180381-65180381
CTexonicDe novononsynonymous SNVNM_001010874c.G536Ap.R179H10.439.0E-4Iossifov2014 E
Ji2016 E
Kosmicki2017 E
TECRL     AU3713302chr4:
63298105-63298105
TGintergenicDe novo--Yuen2017 G
TECRL     AU3728301chr4:
65612366-65612366
AGintergenicDe novo--Yuen2017 G
TECRL     1-0625-003chr4:
63620708-63620709
CTCintergenicDe novo--Yuen2017 G
TECRL     2-1368-003chr4:
65005549-65005549
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
TECRL     AU1987302chr4:
64053861-64053869
TGAATATGGTGintergenicDe novo--Yuen2017 G
TECRL     2-1306-004chr4:
65570018-65570018
CTintergenicDe novo--Yuen2017 G
TECRL     AU4033305chr4:
65217312-65217312
CAintronicDe novo--Yuen2017 G
TECRL     2-1506-003chr4:
63631191-63631207
GATATATATATATATATGATATATATATATATintergenicDe novo--Yuen2017 G
TECRL     2-1366-003chr4:
63811300-63811300
CTintergenicDe novo--Yuen2017 G
TECRL     2-1389-003chr4:
65429863-65429863
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
TECRL     2-1258-004chr4:
63222110-63222110
GCintergenicDe novo--Yuen2017 G
TECRL     AU1542303chr4:
64153861-64153861
GAintergenicDe novo--Yuen2017 G
TECRL     AU4199303chr4:
63560628-63560628
TCintergenicDe novo--Yuen2017 G
TECRL     2-0132-004chr4:
63571400-63571402
AATAintergenicDe novo--Yuen2017 G
TECRL     AU071804chr4:
63233066-63233066
GTintergenicDe novo--Yuen2017 G
TECRL     REACH000214chr4:
65166449-65166449
TGintronicDe novo--Trost2022 G
TECRL     AU031003chr4:
64593329-64593329
TGintergenicDe novo--Yuen2017 G
TECRL     1-1226-003chr4:
65198015-65198019
AAATCAintronicDe novo--Trost2022 G
TECRL     1-0244-003chr4:
64246030-64246030
CGintergenicDe novo--Yuen2016 G
TECRL     AU2320301chr4:
65154895-65154895
TGintronicDe novo--Trost2022 G
TECRL     2-1736-003chr4:
63821028-63821028
TGintergenicDe novo--Yuen2017 G
TECRL     5-5004-003chr4:
65159031-65159031
GAintronicDe novo--Trost2022 G
TECRL     2-1391-003chr4:
65650950-65650950
GGAintergenicDe novo--Yuen2017 G
TECRL     2-0127-004chr4:
65035842-65035842
CTintergenicDe novo--Yuen2017 G
TECRL     AU1952305chr4:
64399773-64399773
GTintergenicDe novo--Yuen2017 G
TECRL     AU4273304chr4:
63438168-63438168
CTintergenicDe novo--Yuen2017 G
TECRL     1-1120-003chr4:
65232130-65232130
TAintronicDe novo--Trost2022 G
TECRL     3-0223-000chr4:
65240206-65240206
GAintronicDe novo--Trost2022 G
TECRL     2-1644-004chr4:
65216755-65216756
CAGCGintronicDe novo--Trost2022 G
TECRL     2-0016-003chr4:
63129824-63129824
TCintergenicDe novo--Yuen2017 G
TECRL     MT_183.3chr4:
65224352-65224352
TAintronicDe novo--Trost2022 G
TECRL     2-1341-004chr4:
64774989-64774989
CAintergenicDe novo--Yuen2017 G
TECRL     2-0297-003chr4:
64885494-64885494
CTintergenicDe novo--Yuen2017 G
TECRL     2-1132-003chr4:
64096931-64096931
TCintergenicDe novo--Yuen2017 G
TECRL     AU056003chr4:
63434188-63434188
GAintergenicDe novo--Yuen2017 G
TECRL     7-0247-003chr4:
63500599-63500599
CTintergenicDe novo--Yuen2017 G
TECRL     AU2293301chr4:
63876767-63876767
GAintergenicDe novo--Yuen2017 G
TECRL     2-1246-003chr4:
63926432-63926432
ATintergenicDe novo--Yuen2017 G
TECRL     1-0354-003chr4:
63378517-63378517
TCintergenicDe novo--Yuen2017 G
TECRL     1-0303-004chr4:
65666879-65666879
CTintergenicDe novo--Yuen2017 G
TECRL     1-0627-003chr4:
63168947-63168947
GAintergenicDe novo--Yuen2017 G
TECRL     AU4013303chr4:
64641221-64641221
CTintergenicDe novo--Yuen2017 G
TECRL     AU054303chr4:
63852216-63852216
TCintergenicDe novo--Yuen2017 G
TECRL     2-1451-004chr4:
65470719-65470719
GAintergenicDe novo--Yuen2017 G
TECRL     2-1605-004chr4:
65666879-65666879
CTintergenicDe novo--Yuen2017 G
TECRL     1-0051-005chr4:
64535077-64535096
AGAAGTTCTCTGTATTTCCTAintergenicDe novo--Yuen2017 G
TECRL     AU3900301chr4:
65717694-65717694
GTintergenicDe novo--Yuen2017 G
TECRL     AU061104chr4:
63938480-63938480
CAintergenicDe novo--Yuen2017 G
TECRL     1-0559-005chr4:
63704764-63704764
GAintergenicDe novo--Yuen2017 G
TECRL     AU066104chr4:
65700302-65700325
TACATATATACATACATATATACATAintergenicDe novo--Yuen2017 G
TECRL     AU045010chr4:
64417195-64417195
AGintergenicDe novo--Yuen2017 G
TECRL     AU061104 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
TECRL     1-0139-003chr4:
63696198-63696198
TCintergenicDe novo--Yuen2017 G
TECRL     13171.p1chr4:
63624840-63624840
GAintergenicDe novo--Turner2016 G
TECRL     2-1619-004chr4:
63959763-63959763
GAintergenicDe novo--Yuen2017 G
TECRL     14637.p1chr4:
63180283-63180283
AGintergenicDe novo--Turner2016 G
TECRL     13539.p1chr4:
63621196-63621196
AGintergenicDe novo--Turner2016 G
TECRL     7-0255-003chr4:
64125543-64125543
GAintergenicDe novo--Yuen2017 G
TECRL     2-1174-005Bchr4:
63169872-63169872
ACintergenicDe novo--Yuen2017 G
TECRL     7-0174-003chr4:
63985560-63985560
TAintergenicDe novo--Yuen2017 G
TECRL     AU0146301chr4:
63325507-63325507
AGintergenicDe novo--Yuen2017 G
TECRL     A9chr4:
65483494-65483494
TTTAintergenicDe novo--Wu2018 G
TECRL     3-0661-000chr4:
64917688-64917699
AAATATAATATAAAATATAintergenicDe novo--Yuen2017 G
TECRL     2-0063-005chr4:
63813219-63813229
CAGATTGTATACintergenicDe novo--Yuen2017 G
TECRL     AU3997302chr4:
63890910-63890910
GAintergenicDe novo--Yuen2017 G
TECRL     AU4314302chr4:
64582561-64582561
TGintergenicDe novo--Yuen2017 G
TECRL     1-0579-003chr4:
63461546-63461558
CCTCTCTCTCTCTCCTCTCTCTCTintergenicDe novo--Yuen2017 G
TECRL     1-0579-003chr4:
63186359-63186380
ACACACACACACGCACACACACACACACACACintergenicDe novo--Yuen2017 G
TECRL     AU2029301chr4:
63587655-63587655
GCintergenicDe novo--Yuen2017 G
TECRL     2-1176-003chr4:
64395921-64395921
TCintergenicDe novo--Yuen2017 G
TECRL     AU3787302chr4:
64520764-64520764
GTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More