or
or
Exact

Results for "MECOM"

Variant Events: 61

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MECOM     3-0305-000chr3:
169124724-169124724
CTintronicDe novo--Trost2022 G
MECOM     5-5146-005chr3:
169126121-169126121
TCintronicDe novo--Trost2022 G
MECOM     MSSNG00054-005chr3:
169090236-169090236
GAintronicDe novo--Trost2022 G
MECOM     10-1127-003Achr3:
169122050-169122050
TCintronicDe novo--Trost2022 G
MECOM     AU1795302chr3:
168804263-168804263
TAintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     2-1784-003chr3:
169081716-169081716
ATintronicDe novo--Trost2022 G
MECOM     REACH000001chr3:
169087171-169087171
GTintronicDe novo--Trost2022 G
MECOM     7-0396-003chr3:
169063619-169063619
CTintronicDe novo--Trost2022 G
MECOM     MSSNG00347-003chr3:
169066851-169066851
TCintronicDe novo--Trost2022 G
MECOM     7-0130-003chr3:
169269981-169269985
ATCACGGCCGintronicDe novo--Trost2022 G
MECOM     1-0952-003chr3:
169269941-169269951
TTGTATACTTTAAAAAAAAAAAintronicDe novo--Trost2022 G
MECOM     2-1299-003chr3:
169269941-169269951
TTGTATACTTTAAAAAAAAAAAintronicDe novo--Trost2022 G
MECOM     2-1502-003chr3:
168901163-168901163
TCintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     MSSNG00122-003chr3:
169233918-169233918
TCintronicDe novo--Trost2022 G
MECOM     3-0029-000chr3:
169240230-169240230
AGintronicDe novo--Trost2022 G
MECOM     09C86141chr3:
168819995-168819995
AGexonicDe novononsynonymous SNVNM_001163999
NM_001164000
NM_001105078
NM_001205194
NM_005241
NM_001105077
NM_004991
c.T2036C
c.T2033C
c.T2060C
c.T2060C
c.T2060C
c.T2255C
c.T2624C
p.M679T
p.M678T
p.M687T
p.M687T
p.M687T
p.M752T
p.M875T
17.25-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
MECOM     AU4150301chr3:
169272630-169272631
TATintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     5-0024-003chr3:
169136163-169136163
GCintronicDe novo--Trost2022 G
MECOM     08C78450chr3:
168838891-168838891
CTexonicDe novononsynonymous SNVNM_001105078
NM_001163999
NM_001164000
NM_001205194
NM_005241
NM_001105077
NM_004991
c.G521A
c.G524A
c.G521A
c.G521A
c.G521A
c.G716A
c.G1085A
p.G174D
p.G175D
p.G174D
p.G174D
p.G174D
p.G239D
p.G362D
22.5-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
MECOM     3-0338-000chr3:
169224834-169224834
TCintronicDe novo--Trost2022 G
MECOM     2-0098-003chr3:
169357855-169357855
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
MECOM     1-0155-003chr3:
169382291-169382291
GAupstreamDe novo--Trost2022 G
Yuen2017 G
MECOM     1-0417-003chr3:
168920467-168920467
CTintronicDe novo--Yuen2017 G
MECOM     13948.p1chr3:
169421321-169421321
GCintergenicDe novo--Werling2018 G
MECOM     AU4487302chr3:
168895853-168895853
CTintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     7-0119-003chr3:
168989188-168989188
GAintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     AU054304chr3:
169026010-169026010
AGintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     5-0017-003chr3:
169137637-169137637
ACintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     1-0585-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
MECOM     AU4410302chr3:
169405226-169405247
CTGTTTGTTTGTTTGTTTGTTTCTGTTTGTTTGTTTGTTTGTTTGTTTintergenicDe novo--Yuen2017 G
MECOM     2-1501-003chr3:
169201748-169201751
ATTCATTCCATCTTCintronicDe novo--Yuen2017 G
MECOM     2-1170-003chr3:
169458687-169458687
GAintergenicDe novo--Yuen2017 G
MECOM     2-1562-004chr3:
169022622-169022622
GGACAAAACATGCCTAAintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     AU053503chr3:
169131032-169131032
CTintronicDe novo--Yuen2017 G
MECOM     AU2089301chr3:
169352929-169352929
CTintronicDe novo--Yuen2017 G
MECOM     1-0277-003chr3:
168875649-168875649
ACintronicDe novo--Yuen2016 G
Yuen2017 G
MECOM     7-0219-003chr3:
169199053-169199053
TGintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     AU046904chr3:
168974513-168974513
GAintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     AU4308302chr3:
169302167-169302167
CAintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     1-0715-003chr3:
169253908-169253908
TCintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     1-0292-005chr3:
169080781-169080781
GTintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     1-0201-005chr3:
169189573-169189573
TGintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     AU009805chr3:
168958830-168958830
TGintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     2-0013-003chr3:
168933045-168933045
TTAintronicDe novo--Yuen2017 G
MECOM     AU2756306chr3:
169082583-169082583
TCintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     12529.p1chr3:
169359500-169359500
GAintronicDe novo--Turner2016 G
MECOM     AU024105chr3:
169121676-169121676
AGintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     5-5203-003chr3:
169023197-169023197
GAintronicDe novo--Trost2022 G
MECOM     7-0249-003chr3:
169344271-169344286
CCTCTCTCTCTCTCTCCCTCTCTCTCTCTCintronicDe novo--Yuen2017 G
MECOM     AU3874301chr3:
169201748-169201751
ATTCATTCCATCTTCintronicDe novo--Yuen2017 G
MECOM     REACH000258chr3:
169054839-169054839
TCintronicDe novo--Trost2022 G
MECOM     1-0296-004chr3:
168885741-168885749
TATATCTTTAAAAAAAAAintronicDe novo--Trost2022 G
MECOM     AU2410302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
MECOM     2-1237-004chr3:
168974434-168974434
GAintronicDe novo--Trost2022 G
MECOM     2-1461-003chr3:
169443225-169443225
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
MECOM     13403.p1chr3:
169025065-169025065
CTintronicDe novo--Werling2018 G
MECOM     SP0076755chr3:
168865391-168865391
CGUTR5De novo--Trost2022 G
MECOM     2-1349-003chr3:
168868794-168868794
TGintronicDe novo--Trost2022 G
MECOM     7-0458-003chr3:
168811528-168811528
GCintronicDe novo--Trost2022 G
MECOM     1-0559-004chr3:
168805691-168805691
ACintronicDe novo--Trost2022 G
Yuen2017 G
MECOM     4-0023-004chr3:
168842065-168842065
AGintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More