or
or
Exact

Results for "DAB1"

Variant Events: 151

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DAB1     2-0309-004chr1:
58109501-58109501
AGintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     2-1184-003chr1:
58416053-58416053
AGintronicDe novo--Yuen2016 G
Yuen2017 G
DAB1     1-0092-004chr1:
57686460-57686461
AACTTTTACintronicDe novo--Trost2022 G
DAB1     MSSNG00242-003chr1:
57686207-57686207
GCintronicDe novo--Trost2022 G
DAB1     3-0409-000chr1:
57693945-57693945
CTintronicDe novo--Trost2022 G
DAB1     MSSNG00424-004chr1:
57688799-57688799
CTintronicDe novo--Trost2022 G
DAB1     1-0059-003Achr1:
57621079-57621079
CTintronicDe novo--Trost2022 G
DAB1     7-0387-003chr1:
57609911-57609911
AGintronicDe novo--Trost2022 G
DAB1     2-1265-003chr1:
58585633-58585633
CTintronicDe novo--Yuen2016 G
Yuen2017 G
DAB1     MT_48.3chr1:
57628972-57628972
TCintronicDe novo--Trost2022 G
DAB1     4-0085-003chr1:
57622879-57622879
AATintronicDe novo--Trost2022 G
DAB1     1-1215-003chr1:
57857042-57857042
TCintronicDe novo--Trost2022 G
DAB1     7-0365-003chr1:
57830751-57830752
ATAintronicDe novo--Trost2022 G
DAB1     MSSNG00433-003chr1:
57870005-57870005
CTintronicDe novo--Trost2022 G
DAB1     AU004403chr1:
57864028-57864028
GAintronicDe novo--Trost2022 G
DAB1     5-0119-003chr1:
57794261-57794261
CTintronicDe novo--Trost2022 G
DAB1     MSSNG00035-003chr1:
57755533-57755533
CGintronicDe novo--Trost2022 G
DAB1     MSSNG00421-005chr1:
57799863-57799863
GTintronicDe novo--Trost2022 G
DAB1     4-0017-003chr1:
57798043-57798043
TAintronicDe novo--Trost2022 G
DAB1     7-0130-003chr1:
57964510-57964510
AACAGintronicDe novo--Trost2022 G
DAB1     MSSNG00242-003chr1:
57959655-57959655
TAintronicDe novo--Trost2022 G
DAB1     MSSNG00043-003chr1:
57983608-57983608
GCintronicDe novo--Trost2022 G
DAB1     5-5046-004chr1:
57982413-57982413
CTintronicDe novo--Trost2022 G
DAB1     REACH000368chr1:
57919032-57919032
AGintronicDe novo--Trost2022 G
DAB1     3-0515-000chr1:
57882844-57882844
TCintronicDe novo--Trost2022 G
DAB1     MSSNG00429-003chr1:
57941771-57941771
GAintronicDe novo--Trost2022 G
DAB1     1-0433-004chr1:
57527856-57527856
CTintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     REACH000718chr1:
57940863-57940863
CTintronicDe novo--Trost2022 G
DAB1     3-0607-000chr1:
58120161-58120161
TCintronicDe novo--Trost2022 G
DAB1     1-1162-003chr1:
58104906-58104906
CTintronicDe novo--Trost2022 G
DAB1     3-0099-001Achr1:
58148090-58148090
GAintronicDe novo--Trost2022 G
DAB1     REACH000089chr1:
58144467-58144467
CTintronicDe novo--Trost2022 G
DAB1     2-1299-003chr1:
58120922-58120922
CGintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     REACH000681chr1:
58024378-58024379
CACintronicDe novo--Trost2022 G
DAB1     REACH000640chr1:
58000177-58000177
CAintronicDe novo--Trost2022 G
DAB1     4-0062-003chr1:
58075080-58075082
TATATAintronicDe novo--Trost2022 G
DAB1     3-0847-000chr1:
58024650-58024650
CTintronicDe novo--Trost2022 G
DAB1     1-0469-003chr1:
57962839-57962839
CTintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     1-1134-003chr1:
58227100-58227100
AGintronicDe novo--Trost2022 G
DAB1     MSSNG00127-003chr1:
58202409-58202409
CGintronicDe novo--Trost2022 G
DAB1     4-0024-003chr1:
58274538-58274539
CTCintronicDe novo--Trost2022 G
DAB1     REACH000322chr1:
58268835-58268835
GAintronicDe novo--Trost2022 G
DAB1     2-1356-003chr1:
58086700-58086714
TGAGAGAGAGAGAGATGAGAGAGAGAGAintronicDe novo--Yuen2017 G
DAB1     2-1501-003chr1:
58784481-58784481
TCintergenicDe novo--Yuen2017 G
DAB1     1-0182-003chr1:
58173282-58173282
CTintronicDe novo--Trost2022 G
DAB1     2-0713-003chr1:
58825157-58825157
TCintergenicDe novo--Yuen2017 G
DAB1     3-0477-000chr1:
58150515-58150515
CAintronicDe novo--Trost2022 G
DAB1     MSSNG00401-003chr1:
58188898-58188898
GAintronicDe novo--Trost2022 G
DAB1     4-0064-004chr1:
58178184-58178186
ATTAintronicDe novo--Trost2022 G
DAB1     MSSNG00341-003chr1:
58449946-58449946
CAintronicDe novo--Trost2022 G
DAB1     MSSNG00062-003chr1:
58444323-58444323
TAintronicDe novo--Trost2022 G
DAB1     MSSNG00081-003chr1:
58460670-58460670
GAintronicDe novo--Trost2022 G
DAB1     2-1807-003chr1:
58453992-58453992
CTintronicDe novo--Trost2022 G
DAB1     5-5007-003chr1:
58410552-58410552
CTintronicDe novo--Trost2022 G
DAB1     REACH000345chr1:
58375465-58375465
CTintronicDe novo--Trost2022 G
DAB1     1-0187-004chr1:
58415457-58415457
AGintronicDe novo--Trost2022 G
DAB1     MT_24.3chr1:
58411467-58411467
GCintronicDe novo--Trost2022 G
DAB1     1-0344-003chr1:
58411158-58411158
CTintronicDe novo--Yuen2017 G
DAB1     AU2951302chr1:
58789368-58789368
CTintergenicDe novo--Yuen2017 G
DAB1     2-0289-004chr1:
58491693-58491699
CTTCTCTTAGTAAATATTGCATGATAGCintronicDe novo--Trost2022 G
DAB1     2-0289-003chr1:
58491693-58491699
CTTCTCTTAGTAAATATTGCATGATAGCintronicDe novo--Trost2022 G
DAB1     1-0986-003chr1:
58042175-58042175
GTintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     7-0392-005chr1:
58516193-58516193
TTTTTAintronicDe novo--Trost2022 G
DAB1     1-1197-003chr1:
58494104-58494104
TAintronicDe novo--Trost2022 G
DAB1     MSSNG00399-003chr1:
58470929-58470929
TCintronicDe novo--Trost2022 G
DAB1     7-0298-004chr1:
58463750-58463750
TCintronicDe novo--Trost2022 G
DAB1     7-0274-003chr1:
58486631-58486631
CTintronicDe novo--Trost2022 G
DAB1     MSSNG00424-003chr1:
58479848-58479848
AGintronicDe novo--Trost2022 G
DAB1     REACH000364chr1:
58644279-58644279
AGintronicDe novo--Trost2022 G
DAB1     3-0183-000chr1:
58633320-58633320
CTintronicDe novo--Trost2022 G
DAB1     AU012803chr1:
57867122-57867122
AGintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     3-0052-000chr1:
58661951-58661951
AGintronicDe novo--Trost2022 G
DAB1     2-0007-004chr1:
58904649-58904649
ATintergenicDe novo--Yuen2017 G
DAB1     AU3122301chr1:
58830363-58830363
GTintergenicDe novo--Yuen2017 G
DAB1     REACH000341chr1:
58651790-58651790
GAintronicDe novo--Trost2022 G
DAB1     7-0361-003chr1:
58593027-58593027
ACintronicDe novo--Trost2022 G
DAB1     SJD_69.3chr1:
58543682-58543683
TATintronicDe novo--Trost2022 G
DAB1     3-0161-000chr1:
58608655-58608655
TCintronicDe novo--Trost2022 G
DAB1     MT_195.4chr1:
58606833-58606833
CTintronicDe novo--Trost2022 G
DAB1     1-1036-003chr1:
58692710-58692710
GCintronicDe novo--Trost2022 G
DAB1     3-0707-000chr1:
58676674-58676674
GAintronicDe novo--Trost2022 G
DAB1     2-1143-003chr1:
58367385-58367385
CTintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     1-0139-005chr1:
58451539-58451553
AACCTAAGTGATCACAintronicDe novo--Yuen2017 G
DAB1     3-0442-000chr1:
58729009-58729009
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
DAB1     1-0629-003chr1:
57803656-57803673
CCTTCTTCTTCTTCTTCTCCTTCTTCTTCTTCTintronicDe novo--Yuen2017 G
DAB1     2-1526-004chr1:
58415213-58415213
CCTintronicDe novo--Yuen2017 G
DAB1     5-0065-003chr1:
58579879-58579879
AGintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     2-1341-003chr1:
58764381-58764381
GAintergenicDe novo--Yuen2017 G
DAB1     AU3859301chr1:
58298561-58298561
TGintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     AU3175303chr1:
58880887-58880896
CAGAAGAAGACAGAAGAintergenicDe novo--Yuen2017 G
DAB1     1-0978-003chr1:
58740790-58740790
GAintergenicDe novo--Yuen2017 G
DAB1     AU1933301chr1:
58299222-58299222
GAintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     1-0804-003chr1:
58616736-58616736
TGintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     AU1894303chr1:
58217709-58217709
CTintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     5-0003-004chr1:
58437764-58437764
ATintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     1-0059-003chr1:
57621079-57621079
CTintronicDe novo--Yuen2017 G
DAB1     2-0144-003chr1:
57796928-57796928
AGintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     AU4392302chr1:
58774623-58774623
AGintergenicDe novo--Yuen2017 G
DAB1     AU1952305chr1:
58174218-58174218
TCintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     1-0436-003chr1:
57500516-57500516
GCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
DAB1     2-1315-003chr1:
57730970-57730970
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
DAB1     AU2100302chr1:
57834252-57834252
CTintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     1-0285-004chr1:
58457290-58457290
CTintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     13946.p1chr1:
58771663-58771663
CAintergenicDe novo--Turner2016 G
DAB1     2-1378-003chr1:
57494928-57494928
TGintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     2-1518-003chr1:
57842140-57842140
TAintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     AU2951303chr1:
58789368-58789368
CTintergenicDe novo--Yuen2017 G
DAB1     2-0063-003chr1:
57703234-57703234
GAintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     2-1283-004chr1:
57756550-57756550
AATATTintronicDe novo--Yuen2017 G
DAB1     1-0279-004chr1:
57775556-57775556
CGintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     1-0279-004chr1:
57624869-57624869
CTintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     1-0404-003chr1:
58416488-58416488
ATintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     1-0225-003chr1:
58842096-58842096
ATintergenicDe novo--Yuen2017 G
DAB1     1-0404-003chr1:
58415910-58415910
AGintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     1-0225-003chr1:
58573275-58573299
CTGTTTTTGTTTTTGTTTTTGTTTTCTGTTTTTGTTTTTGTTTTintronicDe novo--Yuen2017 G
DAB1     1-0404-003chr1:
58880822-58880836
CCTCTCTCTCTCTCTCCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
DAB1     1-0404-003chr1:
58416592-58416592
ATintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     12430.p1chr1:
57839519-57839519
AGintronicDe novo--Werling2018 G
DAB1     2-1189-003chr1:
58226315-58226342
GACACACACACACACAGACACACACACAGACACACACACACAGACACACACACAintronicDe novo--Yuen2017 G
DAB1     2-1297-004chr1:
57509246-57509246
GAintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     AU039304chr1:
58286991-58286991
ATintronicDe novo--Yuen2017 G
DAB1     1-0006-004chr1:
57467805-57467805
TAintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     2-1562-003chr1:
58607971-58607971
GAintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     SP0041691chr1:
57534983-57534983
TCintronicDe novo--Fu2022 E
DAB1     AU4219302chr1:
58507400-58507400
TCintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     SP0078989chr1:
57481142-57481142
GCintronicDe novo--Fu2022 E
DAB1     AU1933302chr1:
58835179-58835179
GAintergenicDe novo--Yuen2017 G
DAB1     AU4033303chr1:
58595880-58595880
GCintronicDe novo--Yuen2017 G
DAB1     2-1364-003chr1:
57916817-57916817
TCintronicDe novo--Yuen2017 G
DAB1     AU3712302chr1:
58543804-58543804
TCintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     AU2029301chr1:
57572963-57572963
GAintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     2-1277-003chr1:
58272540-58272540
AGintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     2-1626-003chr1:
58361308-58361308
ATintronicDe novo--Yuen2017 G
DAB1     2-1626-003chr1:
58361302-58361302
ATintronicDe novo--Yuen2017 G
DAB1     AU3638302chr1:
57545625-57545625
GAintronicDe novo--Trost2022 G
Yuen2017 G
DAB1     2-1330-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2016 G
Yuen2017 G
DAB1     3-0086-000chr1:
57476500-57476500
CTintronicDe novo--Trost2022 G
DAB1     3-0086-000chr1:
57476498-57476498
CTintronicDe novo--Trost2022 G
DAB1     AU004403chr1:
57477852-57477852
TGintronicDe novo--Trost2022 G
DAB1     REACH000668chr1:
57477769-57477769
CTintronicDe novo--Trost2022 G
DAB1     AU060004chr1:
58712476-58712476
GAintronicDe novo--Yuen2017 G
DAB1     3-0086-000chr1:
57476496-57476496
CTintronicDe novo--Trost2022 G
DAB1     REACH000686chr1:
57557001-57557001
CTintronicDe novo--Trost2022 G
DAB1     REACH000705chr1:
57509802-57509802
GAintronicDe novo--Trost2022 G
DAB1     5-5149-003chr1:
57591870-57591870
GCintronicDe novo--Trost2022 G
DAB1     1-1197-003chr1:
57570016-57570016
AGintronicDe novo--Trost2022 G
DAB1     A4chr1:
58728987-58728987
TCintergenicDe novo--Wu2018 G
DAB1     3-0475-000chr1:
57482511-57482511
GAintronicDe novo--Trost2022 G
DAB1     1-1015-003Achr1:
57478252-57478252
AGintronicDe novo--Trost2022 G
DAB1     3-0059-000chr1:
57500589-57500594
TGCAGATintronicDe novo--Trost2022 G
DAB1     REACH000616chr1:
57496868-57496868
CTintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More