or
or
Exact

Results for "DMRT2"

Variant Events: 82

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DMRT2     AU4211304chr9:
1185192-1185192
CTintergenicDe novo--Yuen2017 G
DMRT2     2-1194-003chr9:
1787858-1787858
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
DMRT2     AU0786305chr9:
1376222-1376222
GAintergenicDe novo--Yuen2017 G
DMRT2     SP0001063chr9:
1056867-1056867
CGexonicDe novononsynonymous SNVNM_181872c.C1280Gp.S427C19.69-Fu2022 E
Trost2022 G
Zhou2022 GE
DMRT2     1-0344-003chr9:
1235253-1235253
AGintergenicDe novo--Yuen2017 G
DMRT2     1-0522-003chr9:
1599616-1599616
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
DMRT2     7-0253-004chr9:
1224649-1224649
TGintergenicDe novo--Yuen2017 G
DMRT2     AU4159301chr9:
1625030-1625030
CGintergenicDe novo--Yuen2017 G
DMRT2     AU0780301chr9:
1073334-1073334
CTintergenicDe novo--Yuen2017 G
DMRT2     1-0274-003chr9:
1771982-1771982
CTintergenicDe novo--Yuen2017 G
DMRT2     1-0274-003chr9:
1768809-1768809
AGintergenicDe novo--Yuen2017 G
DMRT2     1-0533-003chr9:
1244631-1244631
AGintergenicDe novo--Yuen2017 G
DMRT2     2-1180-003chr9:
1171358-1171358
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
DMRT2     1-0006-004chr9:
1398454-1398454
ATintergenicDe novo--Yuen2017 G
DMRT2     1-0068-003chr9:
1864441-1864441
CTintergenicDe novo--Yuen2017 G
DMRT2     2-1180-003chr9:
1163004-1163004
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
DMRT2     A7chr9:
1389819-1389819
GAintergenicDe novo--Wu2018 G
DMRT2     iHART2624chr9:
1056884-1056884
CTexonicMaternalstopgainNM_181872c.C1297Tp.R433X37.0-Ruzzo2019 G
DMRT2     AU1894303chr9:
1920574-1920574
GAintergenicDe novo--Yuen2017 G
DMRT2     11792.p1chr9:
1689975-1689975
GAintergenicDe novo--Werling2018 G
DMRT2     5-0033-004chr9:
1601639-1601639
GCintergenicDe novo--Yuen2017 G
DMRT2     AU075207chr9:
1634390-1634390
CAintergenicDe novo--Yuen2017 G
DMRT2     mAGRE2624chr9:
1056884-1056884
CTexonicMaternalstopgainNM_181872c.C1297Tp.R433X37.0-Cirnigliaro2023 G
DMRT2     2-0088-003chr9:
1145195-1145195
CCCATTintergenicDe novo--Yuen2017 G
DMRT2     AU4235302chr9:
1321334-1321334
ACintergenicDe novo--Yuen2017 G
DMRT2     AU2950301chr9:
1816130-1816130
GAintergenicDe novo--Yuen2017 G
DMRT2     DEASD_0065_001chr9:
1056868-1056868
CTexonicDe novosynonymous SNVNM_181872c.C1281Tp.S427S-0.0015DeRubeis2014 E
Kosmicki2017 E
DMRT2     DEASD_0210_001chr9:
1057229-1057229
AGexonicDe novononsynonymous SNVNM_181872c.A1642Gp.I548V14.66-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
DMRT2     3-0438-000chr9:
1886907-1886907
ATintergenicDe novo--Yuen2016 G
DMRT2     2-1163-003chr9:
1788247-1788247
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
DMRT2     2-1626-003chr9:
1248008-1248008
CAintergenicDe novo--Yuen2017 G
DMRT2     AU3846303chr9:
1943331-1943331
AGintergenicDe novo--Yuen2017 G
DMRT2     AU4186302chr9:
1859632-1859632
GCintergenicDe novo--Yuen2017 G
DMRT2     AU4465303chr9:
1152483-1152483
CTintergenicDe novo--Yuen2017 G
DMRT2     5-0133-003chr9:
1254544-1254544
GTintergenicDe novo--Yuen2017 G
DMRT2     AU3397302chr9:
1526696-1526700
TGGGGTGGGintergenicDe novo--Yuen2017 G
DMRT2     13637.p1chr9:
1417177-1417177
ACintergenicDe novo--Wilfert2021 G
DMRT2     2-0144-003chr9:
1098397-1098397
CTintergenicDe novo--Yuen2017 G
DMRT2     A7chr9:
1369850-1369850
GCintergenicDe novo--Wu2018 G
DMRT2     AU2023302chr9:
1174385-1174385
CTintergenicDe novo--Yuen2017 G
DMRT2     A19chr9:
1715014-1715014
TCintergenicDe novo--Wu2018 G
DMRT2     A7chr9:
1375186-1375186
GCintergenicDe novo--Wu2018 G
DMRT2     2-0256-004chr9:
1294125-1294125
AGintergenicDe novo--Yuen2017 G
DMRT2     AU2023302chr9:
1203047-1203047
CGintergenicDe novo--Yuen2017 G
DMRT2     13543.p1chr9:
1688129-1688129
CGintergenicDe novo--Turner2016 G
DMRT2     12011.p1chr9:
1878393-1878393
ATintergenicDe novo--Turner2016 G
DMRT2     12529.p1chr9:
1512472-1512472
CTintergenicDe novo--Turner2016 G
DMRT2     AU024104chr9:
1749335-1749335
GCintergenicDe novo--Yuen2017 G
DMRT2     AU012804chr9:
1672985-1672985
CGintergenicDe novo--Yuen2017 G
DMRT2     AU2023302chr9:
1205641-1205641
CTintergenicDe novo--Yuen2017 G
DMRT2     AU059903chr9:
1195503-1195503
GAintergenicDe novo--Yuen2017 G
DMRT2     AU2023302chr9:
1215240-1215240
CAintergenicDe novo--Yuen2017 G
DMRT2     2-1486-003chr9:
1996660-1996660
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
DMRT2     1-0479-006chr9:
1101458-1101458
TCintergenicDe novo--Yuen2017 G
DMRT2     2-1486-003chr9:
1216552-1216552
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
DMRT2     2-0214-004chr9:
1946441-1946441
AGintergenicDe novo--Yuen2017 G
DMRT2     AU2792302chr9:
1607549-1607549
CTintergenicDe novo--Yuen2017 G
DMRT2     2-1441-003chr9:
1898812-1898812
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
DMRT2     1-0558-003chr9:
1071222-1071222
AGintergenicDe novo--Yuen2017 G
DMRT2     7-0247-003chr9:
1226907-1226908
GAGintergenicDe novo--Yuen2017 G
DMRT2     AU046707chr9:
1151101-1151101
TCintergenicDe novo--Yuen2017 G
DMRT2     2-0305-004chr9:
2001158-2001158
TCintergenicDe novo--Yuen2017 G
DMRT2     7-0032-003chr9:
1812840-1812840
TCintergenicDe novo--Yuen2017 G
DMRT2     AU075803chr9:
1824321-1824321
GAintergenicDe novo--Yuen2017 G
DMRT2     2-1399-003chr9:
1692636-1692636
ATintergenicDe novo--Yuen2017 G
DMRT2     2-1254-003chr9:
1485899-1485899
ACintergenicDe novo--Yuen2016 G
DMRT2     1-0226-005chr9:
1398454-1398454
ATintergenicDe novo--Yuen2017 G
DMRT2     1-0404-003chr9:
1407167-1407171
TTATATTAintergenicDe novo--Yuen2017 G
DMRT2     1-0213-004chr9:
1123303-1123303
CTintergenicDe novo--Yuen2017 G
DMRT2     AU1894304chr9:
1388628-1388628
CTintergenicDe novo--Yuen2017 G
DMRT2     1-0541-004chr9:
1987024-1987024
AGintergenicDe novo--Yuen2017 G
DMRT2     1-0206-004chr9:
1452541-1452541
GAintergenicDe novo--Yuen2017 G
DMRT2     1-0541-004chr9:
1981955-1981955
CGintergenicDe novo--Yuen2017 G
DMRT2     7-0253-005chr9:
1759270-1759270
CTintergenicDe novo--Yuen2017 G
DMRT2     1-0274-004chr9:
1771982-1771982
CTintergenicDe novo--Yuen2017 G
DMRT2     1-0274-004chr9:
1768809-1768809
AGintergenicDe novo--Yuen2017 G
DMRT2     1-0826-004chr9:
1523174-1523174
AGintergenicDe novo--Yuen2017 G
DMRT2     1-0509-003chr9:
1168510-1168510
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
DMRT2     AU2140305chr9:
1538375-1538375
AGintergenicDe novo--Yuen2017 G
DMRT2     2-1180-003chr9:
1159936-1159936
GCintergenicDe novo--Yuen2017 G
DMRT2     2-1426-003chr9:
1884428-1884428
CTintergenicDe novo--Yuen2017 G
DMRT2     AU3900301chr9:
1283878-1283891
CTGTGTGTGTGTGTCTGTGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More