or
or
Exact

Results for "ADARB1"

Variant Events: 33

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADARB1     AU3874303chr21:
46647920-46647920
CTintergenicDe novo--Yuen2017 G
ADARB1     AU3912302chr21:
46576153-46576153
CTintronicDe novo--Trost2022 G
ADARB1     A19chr21:
46547739-46547739
CTintronicDe novo--Wu2018 G
ADARB1     7-0081-003chr21:
46575165-46575165
CTintronicDe novo--Trost2022 G
ADARB1     REACH000405chr21:
46545469-46545469
CTintronicDe novo--Trost2022 G
ADARB1     SJD_23.3chr21:
46514899-46514899
CTintronicDe novo--Trost2022 G
ADARB1     1-0358-003chr21:
46666757-46666757
GTintergenicDe novo--Yuen2017 G
ADARB1     MSSNG00153-003chr21:
46512321-46512321
GCintronicDe novo--Trost2022 G
ADARB1     3-0067-000chr21:
46510872-46510872
ATintronicDe novo--Trost2022 G
ADARB1     1-1162-003chr21:
46500820-46500820
AGintronicDe novo--Trost2022 G
ADARB1     SP0040659chr21:
46641951-46641951
CTexonicDe novononsynonymous SNVNM_001112
NM_001160230
NM_015833
NM_015834
c.C1945T
c.C1945T
c.C2065T
c.C2065T
p.R649C
p.R649C
p.R689C
p.R689C
12.62-Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
ADARB1     SP0127692chr21:
46640972-46640972
CTintronicDe novo--Trost2022 G
ADARB1     MSSNG00100-004chr21:
46628161-46628161
GAintronicDe novo--Trost2022 G
ADARB1     7-0478-003chr21:
46611068-46611068
AATintronicDe novo--Trost2022 G
ADARB1     2-0197-004chr21:
46591117-46591119
AAACTTintronicDe novo--Trost2022 G
ADARB1     7-0429-003chr21:
46576392-46576392
CTintronicDe novo--Trost2022 G
ADARB1     5-0074-003chr21:
46576306-46576306
CTintronicDe novo--Trost2022 G
ADARB1     5-0074-003chr21:
46576289-46576289
CTintronicDe novo--Trost2022 G
ADARB1     AU3912302chr21:
46576158-46576158
CTintronicDe novo--Trost2022 G
ADARB1     1-0441-003chr21:
46529157-46529157
TCintronicDe novo--Yuen2017 G
ADARB1     MSSNG00422-004chr21:
46644463-46644463
GTUTR3De novo--Trost2022 G
ADARB1     AU3720302chr21:
46644463-46644463
GTUTR3De novo--Trost2022 G
ADARB1     SP0032395chr21:
46642115-46642115
CTUTR3De novo-8.999E-5Fu2022 E
Trost2022 G
ADARB1     5-5131-003chr21:
46644463-46644463
GTUTR3De novo--Trost2022 G
ADARB1     SP0090007chr21:
46643840-46643840
TCUTR3De novo--Trost2022 G
ADARB1     SP0038330chr21:
46642351-46642351
GAUTR3De novo--Trost2022 G
ADARB1     AU072504chr21:
46655652-46655652
GAintergenicDe novo--Yuen2017 G
ADARB1     2-0319-003chr21:
46554120-46554120
GGTGCCCGACAGTGGTGTGTGCACCCGACGGGGGTAintronicDe novo--Yuen2017 G
ADARB1     2-1459-003chr21:
46510509-46510509
GAintronicDe novo--Yuen2016 G
Yuen2017 G
ADARB1     14321.p1chr21:
46570567-46570567
TTAintronicDe novo--Werling2018 G
ADARB1     2-1391-004chr21:
46595725-46595725
GAexonicDe novononsynonymous SNVNM_001112
NM_001160230
NM_015833
NM_015834
c.G109A
c.G109A
c.G109A
c.G109A
p.E37K
p.E37K
p.E37K
p.E37K
11.548.275E-6Yuen2017 G
Zhou2022 GE
ADARB1     AU3779302chr21:
46553610-46553610
CCAGTintronicDe novo--Yuen2017 G
ADARB1     086-09-110952chr21:
46602618-46602618
TCexonicDe novosynonymous SNVNM_001112
NM_001160230
NM_015833
NM_015834
c.T1197C
c.T1197C
c.T1197C
c.T1197C
p.S399S
p.S399S
p.S399S
p.S399S
--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More