or
or
Exact

Results for "MRVI1"

Variant Events: 24

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MRVI1     AU3634301chr11:
10675942-10675942
ACintronicDe novo--Trost2022 G
Yuen2017 G
MRVI1     1-0263-003chr11:
10635709-10635709
CGintronicDe novo--Yuen2016 G
MRVI1     4-0062-003chr11:
10656821-10656821
CGintronicDe novo--Trost2022 G
MRVI1     13557.p1chr11:
10724027-10724027
CCTCAAintergenicDe novo--Werling2018 G
MRVI1     5-1003-003chr11:
10690351-10690352
TGATintronicDe novo--Trost2022 G
MRVI1     4-0073-003chr11:
10654802-10654802
GTintronicDe novo--Trost2022 G
MRVI1     4-0062-003chr11:
10656814-10656814
TCintronicDe novo--Trost2022 G
MRVI1     AU4033305 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
MRVI1     AU4013303chr11:
10623446-10623446
GAintronicDe novo--Trost2022 G
Yuen2017 G
MRVI1     13757.p1chr11:
10651133-10651133
TGexonicDe novononsynonymous SNVNM_001098579
NM_001100163
NM_001206880
NM_130385
c.A499C
c.A253C
c.A526C
c.A526C
p.T167P
p.T85P
p.T176P
p.T176P
17.074.209E-5Satterstrom2020 E
MRVI1     1-0453-003chr11:
10742434-10742434
ACintergenicDe novo--Yuen2017 G
MRVI1     2-1562-004chr11:
10739952-10739952
ACintergenicDe novo--Yuen2017 G
MRVI1     1-0080-003chr11:
10715556-10715556
CTupstreamDe novo--Yuen2017 G
MRVI1     2-1269-003chr11:
10731372-10731379
TCAGATTCTCAGATTCCAGATTCintergenicDe novo--Yuen2017 G
MRVI1     2-0126-004chr11:
10638970-10638970
GTintronicDe novo--Trost2022 G
MRVI1     6265chr11:
10651133-10651133
TGexonicDe novononsynonymous SNVNM_001098579
NM_001100163
NM_001206880
NM_130385
c.A499C
c.A253C
c.A526C
c.A526C
p.T167P
p.T85P
p.T176P
p.T176P
17.074.209E-5Trost2022 G
MRVI1     1-0263-003Bchr11:
10635709-10635709
CGintronicDe novo--Trost2022 G
MRVI1     AU070007chr11:
10708651-10708651
ATintronicDe novo--Yuen2017 G
MRVI1     AU2000304chr11:
10697279-10697279
CTintronicDe novo--Trost2022 G
Yuen2017 G
MRVI1     2-0126-004chr11:
10638967-10638967
GTintronicDe novo--Trost2022 G
MRVI1     AU4433301chr11:
10763412-10763419
CAGAGTCTCintergenicDe novo--Yuen2017 G
MRVI1     SP0116020chr11:
10648118-10648119
CTCexonicDe novoframeshift deletionNM_001098579
NM_001100163
NM_130385
c.738delA
c.489delA
c.762delA
p.K246fs
p.K163fs
p.K254fs
--Fu2022 E
Trost2022 G
Zhou2022 GE
MRVI1     MSSNG00021-004chr11:
10626855-10626855
TCintronicDe novo--Trost2022 G
MRVI1     1-0972-003chr11:
10727191-10727191
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More