or
or
Exact

Results for "LOC102723968"

Variant Events: 101

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LOC102723968    2-1297-004chr13:
64887237-64887237
TAintergenicDe novo--Yuen2017 G
LOC102723968    1-0404-003chr13:
64548505-64548517
GTATATATATATAGTATATATATAintergenicDe novo--Yuen2017 G
LOC102723968    AU4007301chr13:
66331945-66331945
AGintergenicDe novo--Yuen2017 G
LOC102723968    AU3790302chr13:
65934480-65934480
CGintergenicDe novo--Yuen2017 G
LOC102723968    7-0103-003chr13:
65161455-65161455
TCintergenicDe novo--Yuen2017 G
LOC102723968    AU2381302chr13:
66231412-66231412
ATintergenicDe novo--Yuen2017 G
LOC102723968    AU4007301chr13:
66331639-66331639
CGintergenicDe novo--Yuen2017 G
LOC102723968    2-0202-004chr13:
66079901-66079905
TAGACTintergenicDe novo--Yuen2017 G
LOC102723968    2-1459-003chr13:
66145737-66145737
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC102723968    2-1350-003chr13:
64897215-64897215
AGintergenicDe novo--Yuen2017 G
LOC102723968    7-0249-004chr13:
64416004-64416004
CTncRNA_intronicDe novo--Yuen2017 G
LOC102723968    1-0206-003chr13:
66395370-66395370
GAintergenicDe novo--Yuen2017 G
LOC102723968    A10chr13:
64492891-64492891
TCintergenicDe novo--Wu2018 G
LOC102723968    2-1086-003chr13:
65680736-65680736
TCintergenicDe novo--Yuen2017 G
LOC102723968    1-0208-003chr13:
65078044-65078044
TCintergenicDe novo--Yuen2017 G
LOC102723968    2-1734-003chr13:
64944883-64944883
CTintergenicDe novo--Yuen2017 G
LOC102723968    1-0196-005chr13:
65418535-65418535
TCintergenicDe novo--Yuen2017 G
LOC102723968    7-0223-003chr13:
65172429-65172429
TGintergenicDe novo--Yuen2017 G
LOC102723968    2-0310-004chr13:
66428394-66428394
CAintergenicDe novo--Yuen2017 G
LOC102723968    2-1441-003chr13:
64965046-64965046
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC102723968    12390.p1chr13:
64884460-64884460
CCAintergenicDe novo, Unknown--Werling2018 G
Wilfert2021 G
LOC102723968    2-0296-003chr13:
65860964-65860967
GTTAGintergenicDe novo--Yuen2017 G
LOC102723968    AU3905302chr13:
64922567-64922567
AGintergenicDe novo--Yuen2017 G
LOC102723968    1-0484-003chr13:
64684664-64684664
TCintergenicDe novo--Yuen2017 G
LOC102723968    AU3913301chr13:
66157143-66157143
GTintergenicDe novo--Yuen2017 G
LOC102723968    1-0590-003chr13:
65403958-65403958
CTintergenicDe novo--Yuen2017 G
LOC102723968    AU060004chr13:
64813595-64813595
AGintergenicDe novo--Yuen2017 G
LOC102723968    2-1509-003chr13:
65821986-65822003
GTTATTATTATTATTATTGTTATTATTATTATTintergenicDe novo--Yuen2017 G
LOC102723968    2-1626-003chr13:
65151726-65151728
TCATintergenicDe novo--Yuen2017 G
LOC102723968    2-1266-003chr13:
65747083-65747083
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC102723968    1-0261-004chr13:
65605770-65605770
CTintergenicDe novo--Yuen2017 G
LOC102723968    5-0138-003chr13:
65971660-65971660
GCintergenicDe novo--Yuen2017 G
LOC102723968    7-0254-003chr13:
65356060-65356060
GAintergenicDe novo--Yuen2017 G
LOC102723968    5-0073-003chr13:
66130851-66130851
TAintergenicDe novo--Yuen2017 G
LOC102723968    1-0460-003chr13:
64629714-64629714
TAintergenicDe novo--Yuen2017 G
LOC102723968    2-1353-003chr13:
64486169-64486169
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC102723968    1-0323-003chr13:
65884299-65884299
GAintergenicDe novo--Yuen2017 G
LOC102723968    AU4122301chr13:
65357951-65357951
AGintergenicDe novo--Yuen2017 G
LOC102723968    2-1452-003chr13:
66089526-66089526
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC102723968    1-0405-003chr13:
65618652-65618652
CAintergenicDe novo--Yuen2017 G
LOC102723968    AU3807302chr13:
65786534-65786534
GCintergenicDe novo--Yuen2017 G
LOC102723968    7-0032-003chr13:
64999829-64999829
GCintergenicDe novo--Yuen2017 G
LOC102723968    14590.p1chr13:
65652856-65652856
TCintergenicDe novo--Turner2016 G
LOC102723968    14153.p1chr13:
65882083-65882083
CTintergenicDe novo--Turner2016 G
LOC102723968    2-1389-003chr13:
64909394-64909394
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC102723968    14153.p1chr13:
64761950-64761950
CTintergenicDe novo--Turner2016 G
LOC102723968    13874.p1chr13:
65066228-65066228
TCintergenicDe novo--Turner2016 G
LOC102723968    AU4007302chr13:
64766213-64766213
GAintergenicDe novo--Yuen2017 G
LOC102723968    1-0652-004chr13:
65618531-65618531
GAintergenicDe novo--Yuen2017 G
LOC102723968    11002.p1chr13:
66415374-66415374
CTintergenicDe novo--Turner2016 G
LOC102723968    AU4260303chr13:
65187602-65187602
GAintergenicDe novo--Yuen2017 G
LOC102723968    13649.p1chr13:
66421191-66421191
TCintergenicDe novo--Turner2016 G
LOC102723968    5-0116-003chr13:
65967847-65967847
AGintergenicDe novo--Yuen2017 G
LOC102723968    2-1382-003chr13:
64938225-64938225
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC102723968    5-0128-003chr13:
66182048-66182048
TCintergenicDe novo--Yuen2017 G
LOC102723968    1-0022-004chr13:
64915563-64915563
ACintergenicDe novo--Yuen2017 G
LOC102723968    AU055004chr13:
66256091-66256091
TCintergenicDe novo--Yuen2017 G
LOC102723968    5-0055-004chr13:
65943488-65943488
CTintergenicDe novo--Yuen2017 G
LOC102723968    AU0636303chr13:
65662170-65662170
TCintergenicDe novo--Yuen2017 G
LOC102723968    AU3122301chr13:
65932175-65932175
GAintergenicDe novo--Yuen2017 G
LOC102723968    AU021204chr13:
65282700-65282700
ATintergenicDe novo--Yuen2017 G
LOC102723968    AU2075302chr13:
64531921-64531921
GCintergenicDe novo--Yuen2017 G
LOC102723968    1-0526-003chr13:
66179517-66179517
TTAintergenicDe novo--Yuen2017 G
LOC102723968    AU066818chr13:
65375633-65375633
CAintergenicDe novo--Yuen2017 G
LOC102723968    5-0025-004chr13:
65861566-65861566
AGintergenicDe novo--Yuen2017 G
LOC102723968    AU3764302chr13:
65291146-65291146
TCintergenicDe novo--Yuen2017 G
LOC102723968    AU3398301chr13:
64460247-64460247
TCintergenicDe novo--Yuen2017 G
LOC102723968    2-0102-004chr13:
65762377-65762377
AGintergenicDe novo--Yuen2017 G
LOC102723968    2-1451-003chr13:
65610324-65610324
CTintergenicDe novo--Yuen2017 G
LOC102723968    2-0202-003chr13:
66079901-66079905
TAGACTintergenicDe novo--Yuen2017 G
LOC102723968    1-0454-003chr13:
66345585-66345585
CAintergenicDe novo--Yuen2017 G
LOC102723968    5-0033-004chr13:
66323209-66323223
TCCTTTAATGCACAGTintergenicDe novo--Yuen2017 G
LOC102723968    1-0668-003chr13:
64973783-64973783
ATintergenicDe novo--Yuen2017 G
LOC102723968    1-0763-004chr13:
65635013-65635017
ATGTGAintergenicDe novo--Yuen2017 G
LOC102723968    AU3964302chr13:
66182598-66182598
TCintergenicDe novo--Yuen2017 G
LOC102723968    AU3862305chr13:
65463370-65463370
CTintergenicDe novo--Yuen2017 G
LOC102723968    2-1375-003chr13:
66380753-66380753
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC102723968    2-1237-003chr13:
65011404-65011404
GAintergenicDe novo--Yuen2017 G
LOC102723968    AU066403chr13:
65144882-65144882
TCintergenicDe novo--Yuen2017 G
LOC102723968    2-1444-003chr13:
66011799-66011799
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC102723968    1-0215-006chr13:
66132768-66132768
ACintergenicDe novo--Yuen2017 G
LOC102723968    AU4228301chr13:
64888498-64888498
CGintergenicDe novo--Yuen2017 G
LOC102723968    2-1366-003chr13:
66380851-66380851
CTintergenicDe novo--Yuen2017 G
LOC102723968    1-0656-003chr13:
66077313-66077313
CTintergenicDe novo--Yuen2017 G
LOC102723968    AU1698301chr13:
65142802-65142802
AGintergenicDe novo--Yuen2017 G
LOC102723968    1-0347-003chr13:
64725290-64725290
GAintergenicDe novo--Yuen2017 G
LOC102723968    1-0595-005chr13:
64543167-64543167
ATintergenicDe novo--Yuen2017 G
LOC102723968    A8chr13:
65605583-65605583
CTintergenicDe novo--Wu2018 G
LOC102723968    2-1421-003chr13:
65828300-65828300
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC102723968    1-0436-003chr13:
65959852-65959867
AAGAGAGAGAGAGAGAAAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
LOC102723968    AU3808304chr13:
66436049-66436054
CATAATCATAATAATintergenicDe novo--Yuen2017 G
LOC102723968    AU4153301chr13:
64539842-64539842
GCintergenicDe novo--Yuen2017 G
LOC102723968    2-0070-004chr13:
64671636-64671636
GAintergenicDe novo--Yuen2017 G
LOC102723968    AU4468301chr13:
64465559-64465559
TAintergenicDe novo--Yuen2017 G
LOC102723968    AU3852301chr13:
66251886-66251886
TAintergenicDe novo--Yuen2017 G
LOC102723968    1-0756-003chr13:
65943249-65943249
ATintergenicDe novo--Yuen2017 G
LOC102723968    2-0310-003chr13:
66428394-66428394
CAintergenicDe novo--Yuen2017 G
LOC102723968    AU3839303chr13:
64474373-64474373
GAintergenicDe novo--Yuen2017 G
LOC102723968    2-1230-003chr13:
66292302-66292302
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC102723968    1-0555-003chr13:
64501826-64501826
TCintergenicDe novo--Yuen2017 G
LOC102723968    AU1894304chr13:
66225062-66225062
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More