or
or
Exact

Results for "MTRNR2L1"

Variant Events: 41

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MTRNR2L1     1-0112-003chr17:
22190188-22190188
TCintergenicDe novo--Yuen2017 G
MTRNR2L1     7-0219-003chr17:
22259008-22259008
CGintergenicDe novo--Yuen2017 G
MTRNR2L1     3-0458-000chr17:
22045720-22045720
TCintergenicDe novo--Yuen2016 G
MTRNR2L1     1-0295-003chr17:
22246641-22246641
ACintergenicDe novo--Yuen2017 G
MTRNR2L1     7-0102-003chr17:
22140713-22140713
AGintergenicDe novo--Yuen2017 G
MTRNR2L1     3-0447-000chr17:
22259650-22259650
AGintergenicDe novo--Yuen2017 G
MTRNR2L1     AU3729301chr17:
22261436-22261436
TCintergenicDe novo--Yuen2017 G
MTRNR2L1     AU063004chr17:
22254517-22254517
CAintergenicDe novo--Yuen2017 G
MTRNR2L1     2-1296-003chr17:
22031303-22031303
GAintergenicDe novo--Yuen2017 G
MTRNR2L1     3-0458-000Achr17:
22045720-22045720
TCintergenicDe novo--Yuen2017 G
MTRNR2L1     12605.p1chr17:
22112776-22112776
GCintergenicDe novo--Werling2018 G
MTRNR2L1     1-0467-005chr17:
22193271-22193271
GAintergenicDe novo--Yuen2017 G
MTRNR2L1     2-1146-003chr17:
22259279-22259279
AGintergenicDe novo--Yuen2017 G
MTRNR2L1     2-1529-003chr17:
22255684-22255684
CTintergenicDe novo--Yuen2017 G
MTRNR2L1     2-1296-003chr17:
22104900-22104905
AATTATAATintergenicDe novo--Yuen2017 G
MTRNR2L1     2-0110-003chr17:
22259327-22259327
TGintergenicDe novo--Yuen2017 G
MTRNR2L1     AU3915301chr17:
22254527-22254527
TAintergenicDe novo--Yuen2017 G
MTRNR2L1     1-0224-004chr17:
22190195-22190195
TCintergenicDe novo--Yuen2017 G
MTRNR2L1     2-1738-003chr17:
22261436-22261436
TCintergenicDe novo--Yuen2017 G
MTRNR2L1     3-0442-000chr17:
22251993-22251993
CAintergenicDe novo--Yuen2017 G
MTRNR2L1     1-0487-003chr17:
22259052-22259052
CTintergenicDe novo--Yuen2017 G
MTRNR2L1     2-1353-003chr17:
22259506-22259506
GTintergenicDe novo--Yuen2017 G
MTRNR2L1     3-0458-000Bchr17:
22045720-22045720
TCintergenicDe novo--Yuen2017 G
MTRNR2L1     A19chr17:
22043175-22043175
CAintergenicDe novo--Wu2018 G
MTRNR2L1     2-1251-003chr17:
22258416-22258416
GCintergenicDe novo--Yuen2017 G
MTRNR2L1     AU0146301chr17:
22261416-22261416
CAintergenicDe novo--Yuen2017 G
MTRNR2L1     AU1795302chr17:
22207921-22207922
CTCTATintergenicDe novo--Yuen2017 G
MTRNR2L1     1-0175-003chr17:
22190188-22190188
TCintergenicDe novo--Yuen2017 G
MTRNR2L1     AU2485305chr17:
22245161-22245161
GAintergenicDe novo--Yuen2017 G
MTRNR2L1     AU2139301chr17:
22184734-22184734
ATintergenicDe novo--Yuen2017 G
MTRNR2L1     AU2485305chr17:
22254517-22254517
CAintergenicDe novo--Yuen2017 G
MTRNR2L1     3-0469-000chr17:
22211976-22211976
GAintergenicDe novo--Yuen2017 G
MTRNR2L1     AU3951302chr17:
22247652-22247652
AGintergenicDe novo--Yuen2017 G
MTRNR2L1     AU3076302chr17:
22259279-22259279
AGintergenicDe novo--Yuen2017 G
MTRNR2L1     AU3903301chr17:
22259290-22259290
TCintergenicDe novo--Yuen2017 G
MTRNR2L1     1-0282-003chr17:
22190212-22190212
CAintergenicDe novo--Yuen2017 G
MTRNR2L1     1-0994-003chr17:
22260181-22260181
CGintergenicDe novo--Yuen2017 G
MTRNR2L1     AU1521301chr17:
22255553-22255553
CAintergenicDe novo--Yuen2017 G
MTRNR2L1     AU4496301chr17:
22258977-22258977
ATintergenicDe novo--Yuen2017 G
MTRNR2L1     1-0153-005chr17:
22183862-22183862
TTCintergenicDe novo--Yuen2017 G
MTRNR2L1     1-0559-004chr17:
22184286-22184286
CCTAAAAACAAAAGTTCAACTCTGTTAGTTGAATAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More