or
or
Exact

Results for "NF1"

Variant Events: 71

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NF1     3-0140-000chr17:
29480036-29480036
TAintronicDe novo--Trost2022 G
NF1     Zhang2023:ASD0162chr17:
29679273-29679273
ATsplicingDe novosplicing22.7-Zhang2023 G
NF1     3-0706-000Achr17:
29482413-29482413
GAintronicDe novo--Trost2022 G
NF1     2-0205-003chr17:
29473272-29473272
AGintronicDe novo--Trost2022 G
NF1     SSC12583chr17:
29496923-29496927
CTGTTCexonicPaternalframeshift deletionNM_000267
NM_001042492
NM_001128147
c.495_498del
c.495_498del
c.495_498del
p.T165fs
p.T165fs
p.T165fs
--Chan2022 G
NF1     1-0760-003chr17:
29474968-29474968
AGintronicDe novo--Trost2022 G
NF1     5-0015-004chr17:
29680159-29680159
TAintronicDe novo--Trost2022 G
Yuen2017 G
NF1     SP0142489chr17:
29587374-29587374
TCintronicDe novo--Trost2022 G
NF1     7-0266-003chr17:
29536050-29536050
AGintronicDe novo--Trost2022 G
NF1     REACH000159 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NF1     SP0002124chr17:
29528406-29528406
CCTintronicDe novo-0.0055Trost2022 G
NF1     MSSNG00053-003chr17:
29533980-29533982
CTTCintronicDe novo--Trost2022 G
NF1     5-0049-003chr17:
29504000-29504000
ATintronicDe novo--Trost2022 G
NF1     MSSNG00352-003chr17:
29522248-29522248
CCTintronicDe novo--Trost2022 G
NF1     AU2756306chr17:
29616842-29616842
TAintronicDe novo--Yuen2017 G
NF1     1-0918-003chr17:
29694990-29694990
TAintronicDe novo--Trost2022 G
Yuen2017 G
NF1     AU099703chr17:
29548968-29548968
TTTexonicMaternalframeshift insertionNM_001128147c.1742dupTp.L581fs--Zhou2019 T
NF1     11108.p1chr17:
29676099-29676103
TCTTATintronicDe novo-4.137E-5Dong2014 E
Kosmicki2017 E
Satterstrom2020 E
NF1     AU065503chr17:
29548968-29548968
TTTexonicMaternalframeshift insertionNM_001128147c.1742dupTp.L581fs--Zhou2019 T
NF1     7-0449-003chr17:
29661093-29661093
AGintronicDe novo--Trost2022 G
NF1     AU065403chr17:
29548968-29548968
TTTexonicMaternalframeshift insertionNM_001128147c.1742dupTp.L581fs--Zhou2019 T
NF1     SSC00803chr17:
29676099-29676103
TCTTATintronicDe novo-4.137E-5Trost2022 G
NF1     7-0240-005chr17:
29585394-29585394
CTexonicDe novosynonymous SNVNM_000267
NM_001042492
c.C4143T
c.C4206T
p.I1381I
p.I1402I
--Trost2022 G
Zhou2022 GE
NF1     SP0128843chr17:
29508506-29508507
AGTexonicframeshift substitutionNM_000267
NM_001042492
NM_001128147
c.653_654T
c.653_654T
c.653_654T
N/A
N/A
N/A
--Zhou2022 GE
NF1     1-0098-003Achr17:
29661858-29661859
ATAexonicDe novoframeshift deletionNM_000267
NM_001042492
c.5753delT
c.5816delT
p.I1918fs
p.I1939fs
--Trost2022 G
Zhou2022 GE
NF1     3-0454-000chr17:
29592359-29592359
TCsplicingDe novosplicing25.7-Trost2022 G
Zhou2022 GE
NF1     1-0051-004chr17:
29629314-29629314
TCintronicDe novo--Trost2022 G
Yuen2017 G
NF1     AU1860301chr17:
29456251-29456251
AGintronicDe novo--Trost2022 G
Yuen2017 G
NF1     AU2215302chr17:
29672736-29672736
AGintronicDe novo--Yuen2017 G
NF1     AU4219302chr17:
29547287-29547287
CAintronicDe novo--Trost2022 G
Yuen2017 G
NF1     14542.p1chr17:
29496923-29496927
CTGTTCexonicPaternalframeshift deletionNM_000267
NM_001042492
NM_001128147
c.495_498del
c.495_498del
c.495_498del
p.T165fs
p.T165fs
p.T165fs
--Lowther2023 G
NF1     009-07-107601chr17:
29670026-29670026
GCsplicingDe novosplicing23.0-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
NF1     2-0299-003chr17:
29493176-29493176
AGintronicDe novo--Trost2022 G
Yuen2017 G
NF1     13882.p1chr17:
29559852-29559852
CGexonicDe novostopgainNM_000267
NM_001042492
c.C3449G
c.C3449G
p.S1150X
p.S1150X
47.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lim2017 E
Lowther2023 G
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
NF1     1-0564-003chr17:
29671593-29671607
TGAGAGAGAGAGAGATGAGAGAGAGAGAintronicDe novo--Yuen2017 G
NF1     SP0028215chr17:
29679350-29679350
CTexonicDe novosynonymous SNVNM_000267
NM_001042492
c.C7470T
c.C7533T
p.V2490V
p.V2511V
-3.297E-5Fu2022 E
Trost2022 G
Zhou2022 GE
NF1     11782.p1chr17:
29677317-29677317
CAexonicDe novononsynonymous SNVNM_000267
NM_001042492
c.C7375A
c.C7438A
p.H2459N
p.H2480N
11.17-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lim2017 E
Sanders2012 E
Wilfert2021 G
Zhou2022 GE
NF1     2-1361-003chr17:
29523865-29523865
TCintronicDe novo--Yuen2017 G
NF1     SP0016289chr17:
29556317-29556317
TGexonicDe novononsynonymous SNVNM_000267
NM_001042492
c.T2684G
c.T2684G
p.M895R
p.M895R
16.69-Fu2022 E
Trost2022 G
Zhou2022 GE
NF1     SP0136128chr17:
29557816-29557816
CGintronicDe novo--Fu2022 E
NF1     SP0141768chr17:
29563000-29563004
CTGATCexonicDe novoframeshift deletionNM_000267
NM_001042492
c.3936_3939del
c.3936_3939del
p.S1312fs
p.S1312fs
--Fu2022 E
Trost2022 G
Zhou2022 GE
NF1     SP0010889chr17:
29490220-29490220
TGexonicDe novononsynonymous SNVNM_000267
NM_001042492
NM_001128147
c.T305G
c.T305G
c.T305G
p.M102R
p.M102R
p.M102R
13.51-Fu2022 E
NF1     SP0139142chr17:
29687571-29687571
CGexonicDe novononsynonymous SNVNM_000267
NM_001042492
c.C8164G
c.C8227G
p.L2722V
p.L2743V
16.43-Fu2022 E
Trost2022 G
Zhou2022 GE
NF1     2-1577-003chr17:
29643232-29643232
GAintronicDe novo--Trost2022 G
Trost2022 G
Yuen2017 G
NF1     TAS_F7056Xchr17:
29562925-29562925
CTintronicDe novo-1.648E-5Satterstrom2020 E
Trost2022 G
NF1     MT_151chr17:
29684327-29684327
GAexonicPaternalnonsynonymous SNVNM_000267
NM_001042492
c.G7847A
c.G7910A
p.R2616Q
p.R2637Q
25.63.298E-5Toma2013 E
NF1     2-0323-004chr17:
29620236-29620236
TCintronicDe novo--Yuen2017 G
NF1     SP0239094chr17:
29559901-29559901
TGsplicingDe novosplicing19.3-Trost2022 G
Zhou2022 GE
NF1     SP0214294chr17:
29528489-29528489
CTexonicstopgainNM_000267
NM_001042492
NM_001128147
c.C1246T
c.C1246T
c.C1246T
p.R416X
p.R416X
p.R416X
26.68.365E-6Zhou2022 GE
NF1     7-0002-003chr17:
29627262-29627263
CTCintronicDe novo--Trost2022 G
Yuen2017 G
NF1     SP0247928chr17:
29588776-29588776
TGexonicnonsynonymous SNVNM_000267
NM_001042492
c.T4562G
c.T4625G
p.L1521R
p.L1542R
27.1-Zhou2022 GE
NF1     AU0452303chr17:
29507773-29507773
GAintronicDe novo--Trost2022 G
Yuen2017 G
NF1     SP0161862chr17:
29585521-29585521
GTsplicingDe novosplicing27.8-Trost2022 G
Zhou2022 GE
NF1     010-07-107482chr17:
29661900-29661900
CGexonicDe novononsynonymous SNVNM_000267
NM_001042492
c.C5794G
c.C5857G
p.L1932V
p.L1953V
22.8-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
NF1     SP0264157chr17:
29684326-29684326
CTexonicstopgainNM_000267
NM_001042492
c.C7846T
c.C7909T
p.R2616X
p.R2637X
35.0-Zhou2022 GE
NF1     SP0322508chr17:
29676174-29676174
CTexonicnonsynonymous SNVNM_000267
NM_001042492
c.C7163T
c.C7226T
p.T2388I
p.T2409I
29.9-Zhou2022 GE
NF1     DEASD_1052_001chr17:
29667594-29667594
TAexonicDe novostopgainNM_000267
NM_001042492
c.T6930A
c.T6993A
p.Y2310X
p.Y2331X
27.0-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
NF1     13314.p1chr17:
29460697-29460699
CAGCintronicDe novo--Werling2018 G
NF1     Hu2022:3chr17:
29552152-29552152
GAexonicDe novononsynonymous SNVNM_000267
NM_001042492
c.G1885A
c.G1885A
p.G629R
p.G629R
11.811.65E-5Hu2022 T
NF1     AU047703chr17:
29691553-29691553
ACintronicDe novo--Trost2022 G
Yuen2017 G
NF1     SP0016664chr17:
29683983-29683985
CAGCexonicDe novoframeshift deletionNM_000267
NM_001042492
c.7682_7683del
c.7745_7746del
p.Q2561fs
p.Q2582fs
--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
NF1     3-0660-000chr17:
29685585-29685587
GAGGexonicMaternalframeshift deletionNM_000267
NM_001042492
c.7996_7997del
c.8059_8060del
p.S2666fs
p.S2687fs
--Chan2022 G
NF1     SP0099595chr17:
29665757-29665757
CAexonicDe novostopgainNM_000267
NM_001042492
c.C6792A
c.C6855A
p.Y2264X
p.Y2285X
24.0-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
NF1     3-0640-000chr17:
29557376-29557376
CTexonicPaternalnonsynonymous SNVNM_000267
NM_001042492
c.C3089T
c.C3089T
p.S1030L
p.S1030L
34.0-Chan2022 G
NF1     SP0128843chr17:
29508502-29508503
GAGexonicDe novoframeshift deletionNM_000267
NM_001042492
NM_001128147
c.650delA
c.650delA
c.650delA
p.E217fs
p.E217fs
p.E217fs
--Antaki2022 GE
Fu2022 E
NF1     AU4356302chr17:
29626181-29626181
TCintronicDe novo--Trost2022 G
Yuen2017 G
NF1     13882_p1chr17:
29559852-29559852
CGexonicDe novostopgainNM_000267
NM_001042492
c.C3449G
c.C3449G
p.S1150X
p.S1150X
47.0-Fu2022 E
NF1     150477chr17:
29560019-29560019
GCsplicingDe novosplicing15.92-Fu2022 E
NF1     11782_p1chr17:
29677317-29677317
CAexonicDe novononsynonymous SNVNM_000267
NM_001042492
c.C7375A
c.C7438A
p.H2459N
p.H2480N
11.17-Fu2022 E
NF1     ASC_11149-1chr17:
29508500-29508500
TCexonicDe novononsynonymous SNVNM_000267
NM_001042492
NM_001128147
c.T647C
c.T647C
c.T647C
p.L216P
p.L216P
p.L216P
23.4-Fu2022 E
NF1     3-0736-000chr17:
29667662-29667663
AGAexonicMaternalframeshift deletionNM_000267
NM_001042492
c.6999delG
c.7062delG
p.K2333fs
p.K2354fs
--Chan2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More