
Results for "Ruzzo2019"

Variant Events: 6209

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
AP1G2     iHART1894chr14:
CATCexonicPaternalframeshift deletionNM_001282474
-3.295E-5Ruzzo2019 G
AP1G2     iHART1891chr14:
CATCexonicPaternalframeshift deletionNM_001282474
-3.295E-5Ruzzo2019 G
DHRS2     iHART1880chr14:
TGTexonicPaternalframeshift deletionNM_005794
-4.978E-5Ruzzo2019 G
DHRS2     iHART1557chr14:
TGsplicingPaternalsplicing--Ruzzo2019 G
NGDN     iHART1362chr14:
32.02.0E-4Ruzzo2019 G
MYH7     iHART1972chr14:
GAexonicMaternalstopgainNM_000257c.C1456Tp.Q486X40.0-Ruzzo2019 G
NGDN     iHART1360chr14:
32.02.0E-4Ruzzo2019 G
NGDN     iHART1361chr14:
32.02.0E-4Ruzzo2019 G
GMPR2     iHART2900chr14:
CGCexonicPaternalframeshift deletionNM_001283022
-1.0E-4Ruzzo2019 G
GMPR2     iHART2902chr14:
CGCexonicPaternalframeshift deletionNM_001283022
-1.0E-4Ruzzo2019 G
TGM1     iHART3242chr14:
TCsplicingPaternalsplicing18.373.0E-4Ruzzo2019 G
TGM1     iHART3240chr14:
TCsplicingPaternalsplicing18.373.0E-4Ruzzo2019 G
IPO4     iHART2431chr14:
ACAexonicPaternalframeshift deletionNM_024658c.1648delGp.V550fs--Ruzzo2019 G
PCK2     iHART3002chr14:
GGGCTGTGGATGAGAexonicPaternalframeshift insertionNM_001018073
-6.694E-5Ruzzo2019 G
GMPR2     iHART2903chr14:
CGCexonicPaternalframeshift deletionNM_001283022
-1.0E-4Ruzzo2019 G
TSSK4     iHART1112chr14:
ACsplicingPaternalsplicing14.21.668E-5Ruzzo2019 G
CBLN3     iHART3032chr14:
GAexonicMaternalstopgainNM_001039771c.C211Tp.R71X39.03.042E-5Ruzzo2019 G
RIPK3     iHART2506chr14:
GAexonicMaternalstopgainNM_006871c.C1339Tp.R447X20.61.0E-4Ruzzo2019 G
COCH     iHART1876chr14:
AAGCTAexonicPaternalframeshift deletionNM_001135058
-8.254E-6Ruzzo2019 G
GZMB     iHART2106chr14:
GAexonicPaternalstopgainNM_004131c.C511Tp.R171X12.418.236E-6Ruzzo2019 G
DHRS1     iHART2774chr14:
35.0-Ruzzo2019 G
DHRS1     iHART2772chr14:
35.0-Ruzzo2019 G
RIPK3     iHART2507chr14:
GAexonicMaternalstopgainNM_006871c.C1339Tp.R447X20.61.0E-4Ruzzo2019 G
ADCY4     iHART2633chr14:
TGTexonicMaternalframeshift deletionNM_001198568
-1.648E-5Ruzzo2019 G
PNN     iHART2845chr14:
CTexonicPaternalstopgainNM_002687c.C2086Tp.R696X37.0-Ruzzo2019 G
SEC23A     iHART2585chr14:
ACAsplicingPaternalsplicing--Ruzzo2019 G
MIA2       iHART2323chr14:
CTexonicPaternalstopgainNM_054024c.C829Tp.Q277X13.09-Ruzzo2019 G
MIA2       iHART2322chr14:
CTexonicPaternalstopgainNM_054024c.C829Tp.Q277X13.09-Ruzzo2019 G
MIPOL1     iHART2155chr14:
AAAAACAATCAAGAACGTGCTexonicPaternalframeshift insertionNM_138731
-1.657E-5Ruzzo2019 G
MIPOL1     iHART2154chr14:
AAAAACAATCAAGAACGTGCTexonicPaternalframeshift insertionNM_138731
-1.657E-5Ruzzo2019 G
SEC23A     iHART2584chr14:
ACAsplicingPaternalsplicing--Ruzzo2019 G
SEC23A     iHART2587chr14:
ACAsplicingPaternalsplicing--Ruzzo2019 G
TOGARAM1     iHART1624chr14:
41.01.661E-5Ruzzo2019 G
C14orf28     iHART1532chr14:
GTGsplicingPaternalsplicing-3.513E-5Ruzzo2019 G
TOGARAM1     iHART2778chr14:
GCTGexonicMaternalframeshift deletionNM_015091
--Ruzzo2019 G
TOGARAM1     iHART2777chr14:
GCTGexonicMaternalframeshift deletionNM_015091
--Ruzzo2019 G
MIA2       iHART2730chr14:
CACexonicMaternalframeshift deletionNM_054024c.914delAp.Q305fs-4.137E-5Ruzzo2019 G
MIA2       iHART2731chr14:
CACexonicMaternalframeshift deletionNM_054024c.914delAp.Q305fs-4.137E-5Ruzzo2019 G
MIA2       iHART2127chr14:
GTexonicMaternalstopgainNM_054024c.G1486Tp.E496X18.51.727E-5Ruzzo2019 G
MIA2       iHART2261chr14:
GGAexonicPaternalframeshift insertionNM_054024c.1082dupAp.E361fs-7.486E-5Ruzzo2019 G
RPL36AL     iHART1192chr14:
GAexonicMaternalstopgainNM_001001c.C22Tp.R8X19.144.181E-5Ruzzo2019 G
LRR1     iHART2550chr14:
TTAexonicPaternalframeshift insertionNM_152329c.567dupAp.I189fs-1.648E-5Ruzzo2019 G
L2HGDH     iHART3126chr14:
CTsplicingMaternalsplicing25.61.647E-5Ruzzo2019 G
POLE2     iHART3295chr14:
GGCTexonicPaternalframeshift insertionNM_001197330
--Ruzzo2019 G
MDGA2     iHART1905chr14:
GGGTAGUTR5Paternal--Ruzzo2019 G
MDGA2     iHART1901chr14:
GGGTAGUTR5Paternal--Ruzzo2019 G
LRR1     iHART2549chr14:
TTAexonicPaternalframeshift insertionNM_152329c.567dupAp.I189fs-1.648E-5Ruzzo2019 G
MDGA2     iHART2726chr14:
PYGL     iHART2303chr14:
CAsplicingMaternalsplicing24.68.251E-6Ruzzo2019 G
PYGL     iHART2305chr14:
CAsplicingMaternalsplicing24.68.251E-6Ruzzo2019 G
NID2     iHART2949chr14:
AACCsplicingMaternalsplicing-1.649E-5Ruzzo2019 G
NID2     iHART2948chr14:
AACCsplicingMaternalsplicing-1.649E-5Ruzzo2019 G
NIN     iHART2474chr14:
38.0-Ruzzo2019 G
L2HGDH     iHART3127chr14:
CTsplicingMaternalsplicing25.61.647E-5Ruzzo2019 G
ABHD12B     iHART1448chr14:
CCGexonicPaternalframeshift insertionNM_181814
--Ruzzo2019 G
NIN     iHART2473chr14:
38.0-Ruzzo2019 G
WDHD1     iHART1034chr14:
CACexonicPaternalframeshift deletionNM_001008396
--Ruzzo2019 G
WDHD1     iHART2472chr14:
42.0-Ruzzo2019 G
WDHD1     iHART2219chr14:
41.0-Ruzzo2019 G
WDHD1     iHART2222chr14:
41.0-Ruzzo2019 G
CGRRF1     iHART1375chr14:
CTexonicPaternalstopgainNM_006568c.C661Tp.Q221X38.08.614E-6Ruzzo2019 G
STYX     iHART3127chr14:
26.5-Ruzzo2019 G
WDHD1     iHART2564chr14:
42.01.0E-4Ruzzo2019 G
WDHD1     iHART2565chr14:
42.01.0E-4Ruzzo2019 G
TOMM20L     iHART1183chr14:
AACAexonicPaternalframeshift deletionNM_207377c.345_346delp.K115fs-2.0E-4Ruzzo2019 G
SLC35F4     iHART3103chr14:
CAsplicingMaternalsplicing25.3-Ruzzo2019 G
KIAA0586     iHART1824chr14:
GCsplicingMaternalsplicing9.4477.866E-5Ruzzo2019 G
KIAA0586     iHART1618chr14:
TTCexonicMaternalframeshift insertionNM_014749
-3.0E-4Ruzzo2019 G
TMEM260     iHART2666chr14:
GTsplicingPaternalsplicing15.458.581E-6Ruzzo2019 G
TMEM260     iHART2023chr14:
GAexonicPaternalstopgainNM_017799c.G740Ap.W247X38.0-Ruzzo2019 G
SLC35F4     iHART3107chr14:
CAsplicingMaternalsplicing25.3-Ruzzo2019 G
TMEM260     iHART2665chr14:
GTsplicingPaternalsplicing15.458.581E-6Ruzzo2019 G
RHOJ     iHART1884chr14:
GTsplicingPaternalsplicing31.08.521E-6Ruzzo2019 G
RHOJ     iHART1883chr14:
GTsplicingPaternalsplicing31.08.521E-6Ruzzo2019 G
SYNE2     iHART2352chr14:
GAsplicingMaternalsplicing22.68.281E-6Ruzzo2019 G
SYNE2     iHART2355chr14:
GAsplicingMaternalsplicing22.68.281E-6Ruzzo2019 G
CCDC175     iHART3265chr14:
TAexonicMaternalstopgainNM_001164399c.A1153Tp.K385X18.1-Ruzzo2019 G
CCDC175     iHART2618chr14:
TCTTCTexonicPaternalframeshift deletionNM_001164399c.1663_1666delp.E555fs--Ruzzo2019 G
TMEM30B     iHART1897chr14:
GGCexonicPaternalframeshift insertionNM_001017970c.552dupGp.P185fs--Ruzzo2019 G
SIX4     iHART1672chr14:
GAexonicPaternalstopgainNM_017420c.C2335Tp.Q779X35.0-Ruzzo2019 G
PPP1R36     iHART2446chr14:
CTexonicPaternalstopgainNM_172365c.C157Tp.Q53X10.039.065E-5Ruzzo2019 G
PPP1R36     iHART2445chr14:
CTexonicPaternalstopgainNM_172365c.C157Tp.Q53X10.039.065E-5Ruzzo2019 G
PPP1R36     iHART2748chr14:
TTTCAGTsplicingMaternalsplicing-2.521E-5Ruzzo2019 G
PPP1R36     iHART2747chr14:
TTTCAGTsplicingMaternalsplicing-2.521E-5Ruzzo2019 G
SYNE2     iHART2383chr14:
GGTGexonicMaternalframeshift deletionNM_182910
--Ruzzo2019 G
SYNE2     iHART2382chr14:
GGTGexonicMaternalframeshift deletionNM_182910
--Ruzzo2019 G
ZBTB1     iHART1274chr14:
CTexonicDe novononsynonymous SNVNM_001123329
16.49-Ruzzo2019 G
ESR2     iHART1256chr14:
41.08.247E-6Ruzzo2019 G
SUSD6     iHART2799chr14:
AGsplicingMaternalsplicing20.4-Ruzzo2019 G
ZFYVE26     iHART2550chr14:
CCTGAGGAGCTCexonicPaternalframeshift deletionNM_015346c.1199_1208delp.E400fs--Ruzzo2019 G
SLC10A1     iHART3007chr14:
CAGAACexonicPaternalframeshift deletionNM_003049c.701_704delp.F234fs-1.759E-5Ruzzo2019 G
SLC10A1     iHART3005chr14:
CAGAACexonicPaternalframeshift deletionNM_003049c.701_704delp.F234fs-1.759E-5Ruzzo2019 G
PLEKHH1     iHART1848chr14:
TGATGTexonicMaternalframeshift deletionNM_020715c.2439_2442delp.L813fs--Ruzzo2019 G
PLEK2     iHART1692chr14:
GGCCAGGGTCAGexonicMaternalframeshift deletionNM_016445c.542_551delp.V181fs--Ruzzo2019 G
ZFYVE26     iHART2549chr14:
CCTGAGGAGCTCexonicPaternalframeshift deletionNM_015346c.1199_1208delp.E400fs--Ruzzo2019 G
VTI1B     iHART1571chr14:
CGCexonicPaternalframeshift deletionNM_006370c.15delCp.A5fs--Ruzzo2019 G
HEATR4     iHART1921chr14:
TTCTexonicPaternalframeshift deletionNM_203309
-1.655E-5Ruzzo2019 G
HEATR4     iHART1768chr14:
TCTCACCCATexonicMaternalframeshift deletionNM_203309
--Ruzzo2019 G
FAM161B     iHART1532chr14:
TTAexonicPaternalframeshift insertionNM_152445c.2077_2078insTp.K693fs-8.238E-6Ruzzo2019 G
FAM161B     iHART1531chr14:
TTAexonicPaternalframeshift insertionNM_152445c.2077_2078insTp.K693fs-8.238E-6Ruzzo2019 G
SLC10A1     iHART2188chr14:
CAGAGCexonicMaternalframeshift deletionNM_003049c.615_618delp.L205fs-4.99E-5Ruzzo2019 G
SLC10A1     iHART3004chr14:
CAGAACexonicPaternalframeshift deletionNM_003049c.701_704delp.F234fs-1.759E-5Ruzzo2019 G
DCAF4     iHART1257chr14:
GCexonicDe novononsynonymous SNVNM_181341
24.0-Ruzzo2019 G
SLC10A1     iHART1025chr14:
GGTGAAGexonicMaternalframeshift deletionNM_003049c.34_38delp.F12fs-2.527E-5Ruzzo2019 G
PROX2     iHART1221chr14:
TCCTTGCTGGTATexonicMaternalframeshift deletionNM_001080408
-8.365E-6Ruzzo2019 G
NPC2     iHART1866chr14:
TAsplicingMaternalsplicing24.3-Ruzzo2019 G
EIF2B2     iHART2837chr14:
GTexonicPaternalstopgainNM_014239c.G415Tp.E139X34.0-Ruzzo2019 G
PROX2     iHART1220chr14:
TCCTTGCTGGTATexonicMaternalframeshift deletionNM_001080408
-8.365E-6Ruzzo2019 G
BBOF1     iHART2988chr14:
CACexonicMaternalframeshift deletionNM_025057c.1554delAp.P518fs--Ruzzo2019 G
BBOF1     iHART2023chr14:
GAGexonicMaternalframeshift deletionNM_025057c.669delAp.R223fs-3.0E-4Ruzzo2019 G
NPC2     iHART1862chr14:
TAsplicingMaternalsplicing24.3-Ruzzo2019 G
ABCD4     iHART2751chr14:
GTexonicPaternalstopgainNM_005050c.C528Ap.Y176X17.81.648E-5Ruzzo2019 G
SAMD15     iHART3114chr14:
CGexonicMaternalstopgainNM_001010860c.C1493Gp.S498X36.08.252E-6Ruzzo2019 G
POMT2     iHART2688chr14:
GAexonicPaternalstopgainNM_013382c.C1417Tp.R473X40.02.471E-5Ruzzo2019 G
ISM2     iHART2788chr14:
GAexonicMaternalstopgainNM_199296c.C1690Tp.Q564X27.4-Ruzzo2019 G
SAMD15     iHART3116chr14:
CGexonicMaternalstopgainNM_001010860c.C1493Gp.S498X36.08.252E-6Ruzzo2019 G
FLVCR2     iHART3183chr14:
TGTexonicPaternalframeshift deletionNM_001195283
-8.236E-6Ruzzo2019 G
JDP2     iHART1220chr14:
--Ruzzo2019 G
IFT43     iHART2150chr14:
ACAexonicMaternalframeshift deletionNM_052873
--Ruzzo2019 G
TTLL5     iHART2704chr14:
CTexonicPaternalstopgainNM_015072c.C2161Tp.R721X41.0-Ruzzo2019 G
SPATA7     iHART1730chr14:
CAAAATCexonicPaternalframeshift deletionNM_001040428
--Ruzzo2019 G
GPR65     iHART1416chr14:
GTGexonicMaternalframeshift deletionNM_003608c.364delTp.F122fs-1.649E-5Ruzzo2019 G
EML5     iHART1403chr14:
CAsplicingPaternalsplicing19.46-Ruzzo2019 G
EML5     iHART1401chr14:
CAsplicingPaternalsplicing19.46-Ruzzo2019 G
NRXN3     iHART1908chr14:
AGexonicDe novononsynonymous SNVNM_004796c.A944Gp.Y315C17.58-Ruzzo2019 G
C14orf178     iHART1536chr14:
CTCexonicPaternalframeshift deletionNM_001173978
-3.0E-4Ruzzo2019 G
GALC     iHART2017chr14:
17.284.975E-5Ruzzo2019 G
TSHR     iHART1108chr14:
GTexonicPaternalstopgainNM_000369c.G2218Tp.E740X37.0-Ruzzo2019 G
SLC24A4     iHART2991chr14:
39.0-Ruzzo2019 G
TC2N     iHART2489chr14:
GGAexonicPaternalframeshift insertionNM_001289134
-1.0E-4Ruzzo2019 G
MOAP1     iHART2424chr14:
CTexonicPaternalstopgainNM_022151c.G27Ap.W9X36.0-Ruzzo2019 G
LGMN     iHART1807chr14:
CGsplicingMaternalsplicing13.111.648E-5Ruzzo2019 G
NRDE2     iHART2788chr14:
GCexonicMaternalstopgainNM_017970c.C1263Gp.Y421X40.0-Ruzzo2019 G
EFCAB11     iHART2899chr14:
GTexonicDe novononsynonymous SNVNM_001284267
24.0-Ruzzo2019 G
TC2N     iHART2490chr14:
GGAexonicPaternalframeshift insertionNM_001289134
-1.0E-4Ruzzo2019 G
CATSPERB     iHART1829chr14:
CCTexonicPaternalframeshift insertionNM_024764c.378dupAp.A127fs--Ruzzo2019 G
SERPINA12     iHART1424chr14:
TATexonicMaternalframeshift deletionNM_001304461
-8.248E-6Ruzzo2019 G
SERPINA9     iHART2424chr14:
GTGexonicPaternalframeshift deletionNM_001284275
-6.624E-5Ruzzo2019 G
ATG2B     iHART1880chr14:
GAexonicMaternalstopgainNM_018036c.C4387Tp.Q1463X50.08.261E-6Ruzzo2019 G
SERPINA12     iHART2211chr14:
CAsplicingPaternalsplicing10.919.892E-5Ruzzo2019 G
UNC79     iHART3145chr14:
CCAGexonicMaternalframeshift insertionNM_020818c.4850_4851insAGp.A1617fs--Ruzzo2019 G
UNC79     iHART3144chr14:
CCAGexonicMaternalframeshift insertionNM_020818c.4850_4851insAGp.A1617fs--Ruzzo2019 G
SERPINA1     iHART2782chr14:
CCGexonicPaternalframeshift insertionNM_000295
-4.947E-5Ruzzo2019 G
ASB2     iHART2627chr14:
GGGCexonicMaternalframeshift insertionNM_016150
-3.703E-5Ruzzo2019 G
EXOC3L4     iHART1818chr14:
AGAexonicPaternalframeshift deletionNM_001077594c.210delGp.K70fs-1.86E-5Ruzzo2019 G
TECPR2     iHART1145chr14:
CTCexonicPaternalframeshift deletionNM_001172631
-7.174E-5Ruzzo2019 G
TDRD9     iHART2473chr14:
CAexonicPaternalstopgainNM_153046c.C540Ap.C180X17.23-Ruzzo2019 G
TDRD9     iHART2474chr14:
CAexonicPaternalstopgainNM_153046c.C540Ap.C180X17.23-Ruzzo2019 G
HHIPL1     iHART2855chr14:
TTGGCCCexonicMaternalframeshift insertionNM_001127258
--Ruzzo2019 G
ATG2B     iHART1879chr14:
GAexonicMaternalstopgainNM_018036c.C4387Tp.Q1463X50.08.261E-6Ruzzo2019 G
ZNF839     iHART2820chr14:
13.99-Ruzzo2019 G
SLC25A29     iHART2516chr14:
CTTCexonicMaternalframeshift deletionNM_152333
--Ruzzo2019 G
MKRN3     iHART3081chr15:
CTexonicMaternalstopgainNM_005664c.C1348Tp.R450X37.0-Ruzzo2019 G
NUDT14     iHART2918chr14:
TCTexonicMaternalframeshift deletionNM_177533c.373delGp.E125fs-1.689E-5Ruzzo2019 G
OCA2     iHART1754chr15:
TTGAexonicMaternalframeshift insertionNM_000275
-1.0E-4Ruzzo2019 G
NPAP1     iHART1327chr15:
CCAGexonicPaternalframeshift insertionNM_018958c.2251_2252insAGp.Q751fs--Ruzzo2019 G
ASPG     iHART2186chr14:
CGGTGCexonicMaternalframeshift deletionNM_001080464c.12_15delp.A4fs--Ruzzo2019 G
ASPG     iHART2188chr14:
CGGTGCexonicMaternalframeshift deletionNM_001080464c.12_15delp.A4fs--Ruzzo2019 G
NUDT14     iHART2916chr14:
TCTexonicMaternalframeshift deletionNM_177533c.373delGp.E125fs-1.689E-5Ruzzo2019 G
PLD4     iHART3047chr14:
GAsplicingPaternalsplicing12.455.0E-4Ruzzo2019 G
AVEN     iHART2268chr15:
GAexonicPaternalstopgainNM_020371c.C4Tp.Q2X36.0-Ruzzo2019 G
RYR3     iHART1183chr15:
49.0-Ruzzo2019 G
CHRM5     iHART1672chr15:
ATexonicPaternalstopgainNM_012125c.A421Tp.K141X41.0-Ruzzo2019 G
CHRM5     iHART1480chr15:
GAsplicingPaternalsplicing--Ruzzo2019 G
TRPM1     iHART3297chr15:
CAsplicingPaternalsplicing13.388.329E-6Ruzzo2019 G
FAM189A1     iHART1383chr15:
GAexonicMaternalstopgainNM_015307c.C787Tp.Q263X17.61-Ruzzo2019 G
TRPM1     iHART2564chr15:
CTsplicingMaternalsplicing28.4-Ruzzo2019 G
TRPM1     iHART2565chr15:
CTsplicingMaternalsplicing28.4-Ruzzo2019 G
FSIP1     iHART3201chr15:
ATAexonicPaternalframeshift deletionNM_152597c.522delAp.K174fs-2.517E-5Ruzzo2019 G
FSIP1     iHART3050chr15:
TTCACexonicMaternalstopgainNM_152597c.1655_1656insGTGp.E552delinsEX--Ruzzo2019 G
GPR176     iHART1268chr15:
37.0-Ruzzo2019 G
GPR176     iHART1271chr15:
37.0-Ruzzo2019 G
KATNBL1     iHART2507chr15:
ACAsplicingMaternalsplicing--Ruzzo2019 G
CHRM5     iHART1374chr15:
GAAGexonicMaternalframeshift deletionNM_012125c.1549_1550delp.K517fs-1.664E-5Ruzzo2019 G
DPH6     iHART3167chr15:
TAGTCTexonicPaternalframeshift deletionNM_080650c.358_361delp.D120fs-4.146E-5Ruzzo2019 G
DPH6     iHART3168chr15:
TAGTCTexonicPaternalframeshift deletionNM_080650c.358_361delp.D120fs-4.146E-5Ruzzo2019 G
KNSTRN     iHART2816chr15:
CTCexonicMaternalframeshift deletionNM_001142761
-1.0E-4Ruzzo2019 G
KNSTRN     iHART2815chr15:
CTCexonicMaternalframeshift deletionNM_001142761
-1.0E-4Ruzzo2019 G
ZFYVE19     iHART1747chr15:
GGTGAGGGTGexonicMaternalframeshift deletionNM_001077268
--Ruzzo2019 G
DNAJC17     iHART1571chr15:
GTexonicPaternalstopgainNM_018163c.C819Ap.Y273X10.11-Ruzzo2019 G
EIF2AK4     iHART2554chr15:
CAexonicPaternalstopgainNM_001013703c.C4766Ap.S1589X42.0-Ruzzo2019 G
EIF2AK4     iHART1583chr15:
CTexonicPaternalstopgainNM_001013703c.C2644Tp.Q882X41.0-Ruzzo2019 G
DISP2     iHART2533chr15:
GAexonicPaternalstopgainNM_033510c.G1697Ap.W566X38.0-Ruzzo2019 G
DISP2     iHART2532chr15:
GAexonicPaternalstopgainNM_033510c.G1697Ap.W566X38.0-Ruzzo2019 G
JMJD7     iHART2988chr15:
AGsplicingPaternalsplicing20.71.0E-4Ruzzo2019 G
RPAP1     iHART1457chr15:
GAexonicPaternalstopgainNM_015540c.C334Tp.R112X28.42.0E-4Ruzzo2019 G
PLA2G4B     iHART2116chr15:
37.02.0E-4Ruzzo2019 G
JMJD7     iHART2989chr15:
AGsplicingPaternalsplicing20.71.0E-4Ruzzo2019 G
SPINT1     iHART2681chr15:
TCTexonicMaternalframeshift deletionNM_001032367
-2.477E-5Ruzzo2019 G
SPINT1     iHART2682chr15:
TCTexonicMaternalframeshift deletionNM_001032367
-2.477E-5Ruzzo2019 G
LTK     iHART2768chr15:
CCAexonicPaternalframeshift insertionNM_001135685
--Ruzzo2019 G
EXD1     iHART2424chr15:
CACexonicMaternalframeshift deletionNM_152596
--Ruzzo2019 G
SPTBN5     iHART2605chr15:
GAexonicPaternalstopgainNM_016642c.C8599Tp.Q2867X48.01.938E-5Ruzzo2019 G
SPTBN5     iHART3044chr15:
GAexonicPaternalstopgainNM_016642c.C9685Tp.Q3229X50.06.561E-5Ruzzo2019 G
SPTBN5     iHART1424chr15:
AACexonicPaternalframeshift insertionNM_016642c.6826dupGp.V2276fs-3.603E-5Ruzzo2019 G
SPTBN5     iHART2791chr15:
GAexonicMaternalstopgainNM_016642c.C6880Tp.R2294X46.03.88E-5Ruzzo2019 G
SPTBN5     iHART1237chr15:
GGCTGAexonicMaternalframeshift insertionNM_016642c.10961_10962insTCAGp.S3654fs-1.0E-4Ruzzo2019 G
PLA2G4B     iHART2334chr15:
CACsplicingMaternalsplicing-7.0E-4Ruzzo2019 G
SPTBN5     iHART3300chr15:
CTsplicingPaternalsplicing12.04-Ruzzo2019 G
SPTBN5     iHART3298chr15:
CTsplicingPaternalsplicing12.04-Ruzzo2019 G
VPS39     iHART2298chr15:
CTsplicingMaternalsplicing19.63-Ruzzo2019 G
SPTBN5     iHART1268chr15:
TCsplicingMaternalsplicing--Ruzzo2019 G
GANC     iHART1443chr15:
AGsplicingMaternalsplicing19.833.375E-5Ruzzo2019 G
GANC     iHART2458chr15:
AGsplicingMaternalsplicing12.196.6E-5Ruzzo2019 G
SPTBN5     iHART1880chr15:
GAexonicPaternalstopgainNM_016642c.C3049Tp.R1017X40.04.424E-5Ruzzo2019 G
SPTBN5     iHART1327chr15:
ACTAexonicMaternalframeshift deletionNM_016642c.6170_6171delp.E2057fs--Ruzzo2019 G
SPTBN5     iHART1271chr15:
TCsplicingMaternalsplicing--Ruzzo2019 G
SPTBN5     iHART1879chr15:
GAexonicPaternalstopgainNM_016642c.C3049Tp.R1017X40.04.424E-5Ruzzo2019 G
STARD9     iHART3059chr15:
CTCexonicPaternalframeshift deletionNM_020759c.3666delTp.P1222fs--Ruzzo2019 G
STARD9     iHART3060chr15:
CTCexonicPaternalframeshift deletionNM_020759c.3666delTp.P1222fs--Ruzzo2019 G
STARD9     iHART2355chr15:
ATexonicPaternalstopgainNM_020759c.A5629Tp.K1877X40.02.0E-4Ruzzo2019 G
STARD9     iHART3249chr15:
CCCTTCexonicMaternalframeshift deletionNM_020759c.5154_5157delp.A1718fs-4.958E-5Ruzzo2019 G
GANC     iHART2274chr15:
TGTexonicPaternalframeshift deletionNM_198141c.1410delGp.V470fs-1.647E-5Ruzzo2019 G
GANC     iHART2272chr15:
TGTexonicPaternalframeshift deletionNM_198141c.1410delGp.V470fs-1.647E-5Ruzzo2019 G
STARD9     iHART1168chr15:
GCsplicingPaternalsplicing20.25.218E-5Ruzzo2019 G
GANC     iHART2934chr15:
GGTexonicMaternalframeshift insertionNM_198141c.2314dupTp.V771fs-1.663E-5Ruzzo2019 G
STARD9     iHART2523chr15:
CCCAGAexonicMaternalframeshift insertionNM_020759c.13716_13717insCAGAp.I4572fs-5.729E-5Ruzzo2019 G
STARD9     iHART1462chr15:
CCTTTAexonicPaternalframeshift insertionNM_020759c.13588_13589insTTTAp.L4530fs--Ruzzo2019 G
STARD9     iHART3216chr15:
AGsplicingMaternalsplicing15.15-Ruzzo2019 G
STARD9     iHART2522chr15:
CCCAGAexonicMaternalframeshift insertionNM_020759c.13716_13717insCAGAp.I4572fs-5.729E-5Ruzzo2019 G
STARD9     iHART1277chr15:
GGAexonicPaternalframeshift insertionNM_020759c.8420dupAp.E2807fs--Ruzzo2019 G
STARD9     iHART2352chr15:
ATexonicPaternalstopgainNM_020759c.A5629Tp.K1877X40.02.0E-4Ruzzo2019 G
STARD9     iHART1461chr15:
CCTTTAexonicPaternalframeshift insertionNM_020759c.13588_13589insTTTAp.L4530fs--Ruzzo2019 G
STARD9     iHART3167chr15:
CTexonicMaternalstopgainNM_020759c.C11158Tp.Q3720X52.05.739E-5Ruzzo2019 G
UBR1     iHART2253chr15:
GGTexonicMaternalframeshift insertionNM_174916c.4745dupAp.N1582fs--Ruzzo2019 G
UBR1     iHART2255chr15:
GGTexonicMaternalframeshift insertionNM_174916c.4745dupAp.N1582fs--Ruzzo2019 G
TGM7     iHART3249chr15:
TCATexonicPaternalframeshift deletionNM_052955c.677_678delp.V226fs--Ruzzo2019 G
CCNDBP1     iHART3041chr15:
GGCexonicPaternalframeshift insertionNM_012142c.11dupCp.A4fs--Ruzzo2019 G
CDAN1     iHART2410chr15:
TGGGAGTexonicMaternalframeshift deletionNM_138477c.3072_3076delp.P1024fs--Ruzzo2019 G
CDAN1     iHART2409chr15:
TGGGAGTexonicMaternalframeshift deletionNM_138477c.3072_3076delp.P1024fs--Ruzzo2019 G
TTBK2     iHART2748chr15:
GAexonicPaternalstopgainNM_173500c.C1321Tp.R441X38.08.294E-6Ruzzo2019 G
CDAN1     iHART2412chr15:
TGGGAGTexonicMaternalframeshift deletionNM_138477c.3072_3076delp.P1024fs--Ruzzo2019 G
SERF2     iHART2310chr15:
AGAexonicPaternalframeshift deletionNM_001199875
--Ruzzo2019 G
PDIA3     iHART1629chr15: