
Results for "HPS6"

Variant Events: 11

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
HPS6     SP0079441chr10:
CTexonicstopgainNM_024747c.C1708Tp.Q570X15.1-Zhou2022 GE
HPS6     2-1235-003chr10:
CTexonicDe novosynonymous SNVNM_024747c.C1453Tp.L485L--Trost2022 G
Yuen2015 G
HPS6     2-1738-003chr10:
CAexonicDe novosynonymous SNVNM_024747c.C144Ap.P48P--Trost2022 G
Yuen2017 G
Zhou2022 GE
HPS6     SP0074175chr10:
CGexonicDe novononsynonymous SNVNM_024747c.C2186Gp.P729R12.07-Fu2022 E
Trost2022 G
Zhou2022 GE
HPS6     SP0083107chr10:
GGCCTGCGGGTACTACCAGCGGCGGAGexonicDe novoframeshift deletionNM_024747c.1219_1243delp.A407fs-8.414E-6Fu2022 E
Zhou2022 GE
HPS6     SP0128942chr10:
GCexonicDe novononsynonymous SNVNM_024747c.G1922Cp.G641A4.327-Fu2022 E
Trost2022 G
Zhou2022 GE
HPS6     NDAR_INVFU720GFQ_wes1chr10:
CTexonicDe novononsynonymous SNVNM_024747c.C791Tp.P264L11.16-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
HPS6     Cukier2014:7435chr10:
GAexonicUnknownnonsynonymous SNVNM_024747c.G634Ap.V212M12.632.0E-4Cukier2014 E
HPS6     iHART3032chr10:
CTexonicPaternalstopgainNM_024747c.C1306Tp.Q436X28.0-Ruzzo2019 G
HPS6     mAGRE3032chr10:
CTexonicPaternalstopgainNM_024747c.C1306Tp.Q436X28.0-Cirnigliaro2023 G
HPS6     1-0640-003chr10:
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView