or
or
Exact

Results for "MYO5A"

Variant Events: 44

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MYO5A     MSSNG00031-003chr15:
52668566-52668566
CTexonicDe novononsynonymous SNVNM_000259
NM_001142495
c.G2398A
c.G2398A
p.V800M
p.V800M
16.66-Trost2022 G
Zhou2022 GE
MYO5A     4-0077-003chr15:
52689540-52689540
TCexonicDe novononsynonymous SNVNM_000259
NM_001142495
c.A1177G
c.A1177G
p.K393E
p.K393E
14.25-Trost2022 G
Zhou2022 GE
MYO5A     AU2433303chr15:
52610395-52610395
GAintronicDe novo--Yuen2017 G
MYO5A     AU072505chr15:
52735680-52735680
CTintronicDe novo--Yuen2017 G
MYO5A     iHART2844chr15:
52688583-52688583
ATexonicDe novononsynonymous SNVNM_000259
NM_001142495
c.T1331A
c.T1331A
p.F444Y
p.F444Y
27.1-Ruzzo2019 G
MYO5A     iHART1691chr15:
52611497-52611497
CAexonicDe novononsynonymous SNVNM_001142495
NM_000259
c.G4838T
c.G4919T
p.G1613V
p.G1640V
23.4-Ruzzo2019 G
MYO5A     7-0002-003chr15:
52685466-52685466
TTGGintronicDe novo--Trost2022 G
Yuen2017 G
MYO5A     SP0032576chr15:
52645809-52645809
GTexonicDe novostopgainNM_000259
NM_001142495
c.C3614A
c.C3614A
p.S1205X
p.S1205X
43.0-Antaki2022 GE
Fu2022 E
Zhou2022 GE
MYO5A     AU228Achr15:
52718114-52718114
ACexonicDe novononsynonymous SNVNM_000259
NM_001142495
c.T368G
c.T368G
p.I123S
p.I123S
21.7-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
MYO5A     13942.p1chr15:
52668933-52668933
GCintronicDe novo--Turner2016 G
MYO5A     1-0339-004chr15:
52675339-52675339
GTexonicDe novononsynonymous SNVNM_000259
NM_001142495
c.C1961A
c.C1961A
p.T654N
p.T654N
24.3-Trost2022 G
Yuen2015 G
Yuen2017 G
Zhou2022 GE
MYO5A     SSC08169chr15:
52643532-52643532
GAexonicDe novosynonymous SNVNM_000259
NM_001142495
c.C3768T
c.C3768T
p.S1256S
p.S1256S
-5.796E-5Fu2022 E
Trost2022 G
MYO5A     13946.p1chr15:
52731551-52731551
CTintronicDe novo--Turner2016 G
MYO5A     14482.p1chr15:
52821164-52821164
CTUTR5De novo--Turner2016 G
MYO5A     5-0512-003chr15:
52745011-52745011
CGintronicDe novo--Trost2022 G
MYO5A     mAGRE2844chr15:
52688583-52688583
ATexonicDe novononsynonymous SNVNM_000259
NM_001142495
c.T1331A
c.T1331A
p.F444Y
p.F444Y
27.1-Cirnigliaro2023 G
MYO5A     5-0512-003chr15:
52745662-52745662
AATintronicDe novo--Trost2022 G
MYO5A     mAGRE1691chr15:
52611497-52611497
CAexonicDe novononsynonymous SNVNM_001142495
NM_000259
c.G4838T
c.G4919T
p.G1613V
p.G1640V
23.4-Cirnigliaro2023 G
MYO5A     7-0012-003chr15:
52683888-52683888
CTintronicDe novo--Trost2022 G
Yuen2017 G
MYO5A     AU2463301chr15:
52612199-52612199
CTintronicDe novo--Trost2022 G
MYO5A     MSSNG00439-003chr15:
52660550-52660550
GCintronicDe novo--Trost2022 G
MYO5A     SP0022671chr15:
52632456-52632456
GGGGCAGCTGCAGGTTCTGGGCCexonicDe novononframeshift insertionNM_001142495
NM_000259
c.4094_4095insGGCCCAGAACCTGCAGCTGCC
c.4175_4176insGGCCCAGAACCTGCAGCTGCC
p.P1365delinsPAQNLQLP
p.P1392delinsPAQNLQLP
--Fu2022 E
Zhou2022 GE
MYO5A     13543.p1chr15:
52643532-52643532
GAexonicDe novosynonymous SNVNM_000259
NM_001142495
c.C3768T
c.C3768T
p.S1256S
p.S1256S
-5.796E-5Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Turner2016 G
Zhou2022 GE
MYO5A     2-0063-003chr15:
52632541-52632541
GAexonicDe novononsynonymous SNVNM_001142495
NM_000259
c.C4010T
c.C4091T
p.A1337V
p.A1364V
13.85-Trost2022 G
Yuen2015 G
Yuen2017 G
Zhou2022 GE
MYO5A     615-05-104639chr15:
52606359-52606359
ACexonicDe novononsynonymous SNVNM_001142495
NM_000259
c.T5295G
c.T5376G
p.F1765L
p.F1792L
25.8-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
MYO5A     SP0034123chr15:
52609264-52609264
TCexonicDe novononsynonymous SNVNM_001142495
NM_000259
c.A5234G
c.A5315G
p.N1745S
p.N1772S
9.3672.484E-5Fu2022 E
Zhou2022 GE
MYO5A     5-5171-003chr15:
52604040-52604040
TAUTR3De novo--Trost2022 G
MYO5A     14068.p1chr15:
52675342-52675342
GCexonicDe novononsynonymous SNVNM_000259
NM_001142495
c.C1958G
c.C1958G
p.T653S
p.T653S
28.6-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Zhou2022 GE
MYO5A     1-0161-003chr15:
52751697-52751697
TCintronicDe novo--Yuen2017 G
MYO5A     1-0820-003chr15:
52783280-52783280
TCintronicDe novo--Trost2022 G
Yuen2017 G
MYO5A     SP0083863chr15:
52672133-52672133
CTintronicDe novo--Fu2022 E
MYO5A     1-0844-004chr15:
52822227-52822227
AGupstreamDe novo--Trost2022 G
MYO5A     1-1034-003chr15:
52801262-52801262
GAintronicDe novo--Trost2022 G
MYO5A     2-0306-004chr15:
52817107-52817107
TAintronicDe novo--Trost2022 G
MYO5A     P2M7G_01chr15:
52782611-52782611
GAintronicDe novo--Trost2022 G
MYO5A     2-0733-003chr15:
52787183-52787183
TGintronicDe novo--Trost2022 G
MYO5A     SSC10290chr15:
52675342-52675342
GCexonicDe novononsynonymous SNVNM_000259
NM_001142495
c.C1958G
c.C1958G
p.T653S
p.T653S
28.6-Fu2022 E
Lim2017 E
Trost2022 G
MYO5A     1-0853-003chr15:
52766445-52766445
GCintronicDe novo--Trost2022 G
MYO5A     AUTPGX_1020chr15:
52779995-52779995
GCintronicDe novo--Trost2022 G
MYO5A     2-0295-004chr15:
52805313-52805313
GAintronicDe novo--Trost2022 G
Yuen2017 G
MYO5A     AU3730301chr15:
52610728-52610728
CTintronicDe novo--Trost2022 G
Yuen2017 G
MYO5A     2-1368-003chr15:
52644087-52644087
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
MYO5A     sBRK-05–01chr15:
52676446-52676446
CTexonicDe novononsynonymous SNVNM_000259
NM_001142495
c.G1826A
c.G1826A
p.R609H
p.R609H
22.66.625E-5Abdi2023 G
MYO5A     1-0448-003chr15:
52629754-52629754
GAintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More