or
or
Exact

Results for "DKK3"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DKK3     2-0116-004chr11:
12126655-12126655
GAintergenicDe novo--Yuen2017 G
DKK3     TRE_2629chr11:
11986114-11986114
AGexonicDe novononsynonymous SNVNM_001018057
NM_013253
NM_015881
c.T950C
c.T950C
c.T950C
p.V317A
p.V317A
p.V317A
24.9-Fu2022 E
DKK3     7-0356-003chr11:
12000611-12000611
TCintronicDe novo--Trost2022 G
DKK3     4-0019-003chr11:
12006434-12006434
AGintronicDe novo--Trost2022 G
DKK3     AU4392302chr11:
12043691-12043691
CTintergenicDe novo--Yuen2017 G
DKK3     1-0524-003chr11:
12112547-12112547
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
DKK3     1-0345-003chr11:
11986190-11986190
GAexonicDe novononsynonymous SNVNM_001018057
NM_013253
NM_015881
c.C874T
c.C874T
c.C874T
p.R292C
p.R292C
p.R292C
18.15-Trost2022 G
Yuen2015 G
Yuen2017 G
Zhou2022 GE
DKK3     7-0001-003chr11:
11995757-11995757
CTintronicDe novo--Trost2022 G
Yuen2017 G
DKK3     SP0081029chr11:
11986116-11986116
CGexonicDe novononsynonymous SNVNM_001018057
NM_013253
NM_015881
c.G948C
c.G948C
c.G948C
p.E316D
p.E316D
p.E316D
17.44-Fu2022 E
Trost2022 G
Zhou2022 GE
DKK3     mAGRE5885chr11:
12023861-12023861
GAexonicMaternalstopgainNM_001018057
NM_013253
NM_015881
c.C337T
c.C337T
c.C337T
p.R113X
p.R113X
p.R113X
39.04.129E-5Cirnigliaro2023 G
DKK3     mAGRE5672chr11:
11987477-11987497
CCACGGGCAGGGGTGTGCACACexonicMaternalframeshift deletionNM_001018057
NM_013253
NM_015881
c.689_708del
c.689_708del
c.689_708del
p.V230fs
p.V230fs
p.V230fs
--Cirnigliaro2023 G
DKK3     1-1155-003chr11:
12025055-12025055
AGintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More