or
or
Exact

Results for "LRFN2"

Variant Events: 55

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LRFN2     3-0116-001chr6:
40432593-40432593
CGintronicDe novo--Trost2022 G
LRFN2     MSSNG00343-004chr6:
40432733-40432733
GTintronicDe novo--Trost2022 G
LRFN2     7-0309-004chr6:
40424505-40424505
CTintronicDe novo--Trost2022 G
LRFN2     4-0082-003chr6:
40428662-40428662
CAintronicDe novo--Trost2022 G
LRFN2     3-0221-000chr6:
40411964-40411965
TGATintronicDe novo--Trost2022 G
LRFN2     2-1625-003chr6:
40416490-40416490
TAintronicDe novo--Trost2022 G
LRFN2     MSSNG00417-003chr6:
40404542-40404542
AGintronicDe novo--Trost2022 G
LRFN2     AU031403chr6:
40734330-40734330
GAintergenicDe novo--Yuen2017 G
LRFN2     AU4159301chr6:
40797060-40797060
CTintergenicDe novo--Yuen2017 G
LRFN2     REACH000364chr6:
40405001-40405001
GTintronicDe novo--Trost2022 G
LRFN2     5-0051-003chr6:
40528167-40528167
CTintronicDe novo--Trost2022 G
LRFN2     3-0489-000chr6:
40491488-40491488
ATintronicDe novo--Trost2022 G
LRFN2     MT_54.3chr6:
40511107-40511107
GAintronicDe novo--Trost2022 G
LRFN2     2-1198-003chr6:
40463287-40463287
ATintronicDe novo--Trost2022 G
LRFN2     2-1328-003chr6:
40425262-40425262
AAGCACCintronicDe novo--Trost2022 G
Yuen2016 G
LRFN2     1-1006-003Achr6:
40473956-40473956
TCintronicDe novo--Trost2022 G
LRFN2     AU2793301chr6:
40734810-40734810
GAintergenicDe novo--Yuen2017 G
LRFN2     AU2035301chr6:
40423371-40423371
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRFN2     12493.p1chr6:
40361860-40361860
CGintronicDe novo--Turner2016 G
LRFN2     11002.p1chr6:
40691072-40691072
GAintergenicDe novo--Turner2016 G
LRFN2     1-0169-003chr6:
40622763-40622763
TTGGTGAintergenicDe novo--Yuen2017 G
LRFN2     1-0190-003chr6:
40749247-40749247
CTintergenicDe novo--Yuen2017 G
LRFN2     AU3779302chr6:
40640681-40640681
AGintergenicDe novo--Yuen2017 G
LRFN2     13393.p1chr6:
40784556-40784556
CTintergenicDe novo--Turner2016 G
LRFN2     72-1397chr6:
40400491-40400491
CTexonicInheritednonsynonymous SNVNM_020737c.G362Ap.R121Q18.422.475E-5Patowary2019 E
LRFN2     1-0498-003chr6:
40542969-40542969
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRFN2     2-0285-003chr6:
40604323-40604323
AGintergenicDe novo--Yuen2017 G
LRFN2     1-0936-003chr6:
40613981-40613981
GAintergenicDe novo--Yuen2017 G
LRFN2     1-0923-003chr6:
40440914-40440914
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRFN2     1-0459-003chr6:
40719526-40719565
CCTCAGACTGGGGCTCCCTGAGGACGGGGCTGCGTCTGCTCintergenicDe novo--Yuen2017 G
LRFN2     2-1440-003chr6:
40418318-40418318
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LRFN2     2-0149-004chr6:
40771069-40771069
AGintergenicDe novo--Yuen2017 G
LRFN2     AC05-0002-01chr6:
40360282-40360282
TGexonicDe novosynonymous SNVNM_020737c.A1770Cp.A590A-1.0E-4Fu2022 E
LRFN2     SSC02460chr6:
40399693-40399693
CTexonicDe novononsynonymous SNVNM_020737c.G1160Ap.S387N0.993-Fu2022 E
Trost2022 G
LRFN2     SSC11825chr6:
40400210-40400211
CACexonicDe novoframeshift deletionNM_020737c.642delTp.P214fs--Fu2022 E
Trost2022 G
LRFN2     2-1632-003chr6:
40812333-40812333
ACintergenicDe novo--Yuen2017 G
LRFN2     Wang2023:325chr6:
40399870-40399870
CTexonicDe novononsynonymous SNVNM_020737c.G983Ap.R328H16.759.218E-5Wang2023 E
LRFN2     2-1522-003chr6:
40373368-40373368
GTintronicDe novo--Trost2022 G
Yuen2017 G
LRFN2     AU011604chr6:
40630869-40630869
TCintergenicDe novo--Yuen2017 G
LRFN2     2-1375-003chr6:
40572139-40572139
CAintergenicDe novo--Yuen2017 G
LRFN2     1-0292-005chr6:
40538790-40538790
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRFN2     2-1178-003chr6:
40404734-40404750
AGTGTGTGTGTGTGTGTAGTGTGTGTGTGTGTintronicDe novo--Yuen2017 G
LRFN2     AU026412chr6:
40705513-40705513
GCintergenicDe novo--Yuen2017 G
LRFN2     11234.p1chr6:
40399693-40399693
CTexonicDe novononsynonymous SNVNM_020737c.G1160Ap.S387N0.993-Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Zhou2022 GE
LRFN2     14477.p1chr6:
40400210-40400211
CACexonicDe novoframeshift deletionNM_020737c.642delTp.P214fs--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
Zhou2022 GE
LRFN2     1-0458-005chr6:
40622721-40622721
TTGGCintergenicDe novo--Yuen2017 G
LRFN2     2-1169-003chr6:
40622937-40622937
TTAGTAATAATGATGGTTACAintergenicDe novo--Yuen2017 G
LRFN2     AU2817301chr6:
40384624-40384624
GAintronicDe novo--Trost2022 G
LRFN2     MT_167.3chr6:
40403360-40403360
CCTCTGintronicDe novo--Trost2022 G
LRFN2     2-1195-003chr6:
40703977-40703977
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LRFN2     SP0216906chr6:
40360154-40360154
GAexonicDe novononsynonymous SNVNM_020737c.C1898Tp.A633V4.5074.448E-5Trost2022 G
LRFN2     AU2035302chr6:
40423371-40423371
GAintronicDe novo--Yuen2017 G
LRFN2     1-0347-003chr6:
40362957-40362957
GAintronicDe novo--Trost2022 G
LRFN2     AU4306302chr6:
40816387-40816387
AGintergenicDe novo--Yuen2017 G
LRFN2     2-1781-003chr6:
40399624-40399624
CTexonicDe novononsynonymous SNVNM_020737c.G1229Ap.G410E3.549-Trost2022 G
Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More