or
or
Exact

Results for "CENPJ"

Variant Events: 27

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CENPJ     AU073003chr13:
25458853-25458853
TCintronicDe novo--Yuen2017 G
CENPJ     A2chr13:
25466563-25466563
CAintronicDe novo--Wu2018 G
CENPJ     5-0014-003chr13:
25479316-25479316
GCintronicDe novo--Trost2022 G
Yuen2017 G
CENPJ     5-0109-003chr13:
25455886-25455886
ACdownstreamDe novo--Trost2022 G
Yuen2017 G
CENPJ     10C109030chr13:
25486801-25486801
GCexonicDe novononsynonymous SNVNM_018451c.C363Gp.N121K5.539-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
CENPJ     Li2017:19646chr13:
25480856-25480856
CCAAexonicUnknownframeshift insertionNM_018451c.1319_1320insTTp.K440fs--Li2017 T
CENPJ     mAGRE5936chr13:
25480590-25480590
GCexonicPaternalstopgainNM_018451c.C1586Gp.S529X17.254.978E-5Cirnigliaro2023 G
CENPJ     1-0372-003chr13:
25486801-25486801
GCexonicDe novononsynonymous SNVNM_018451c.C363Gp.N121K5.539-Yuen2016 G
Yuen2017 G
Zhou2022 GE
CENPJ     mAGRE5935chr13:
25480590-25480590
GCexonicPaternalstopgainNM_018451c.C1586Gp.S529X17.254.978E-5Cirnigliaro2023 G
CENPJ     11254.p1chr13:
25473648-25473648
AGexonicnonsynonymous SNVNM_018451c.T2900Cp.M967T5.948-Zhou2022 GE
CENPJ     mAGRE2912chr13:
25480590-25480590
GCexonicMaternalstopgainNM_018451c.C1586Gp.S529X17.254.978E-5Cirnigliaro2023 G
CENPJ     mAGRE2623chr13:
25478198-25478198
TAsplicingMaternalsplicing16.61-Cirnigliaro2023 G
CENPJ     2-1239-003chr13:
25488179-25488193
GACACACACACACACGACACACACACACintronicDe novo--Yuen2017 G
CENPJ     mAGRE2622chr13:
25478198-25478198
TAsplicingMaternalsplicing16.61-Cirnigliaro2023 G
CENPJ     74-0765chr13:
25487103-25487103
TAexonicInheritednonsynonymous SNVNM_018451c.A61Tp.M21L23.40.0107Patowary2019 E
CENPJ     152-HSC0079chr13:
25487103-25487103
TAexonicInheritednonsynonymous SNVNM_018451c.A61Tp.M21L23.40.0107Patowary2019 E
CENPJ     AU043804chr13:
25469925-25469925
ACintronicDe novo--Trost2022 G
Yuen2017 G
CENPJ     iHART2622chr13:
25478198-25478198
TAsplicingMaternalsplicing16.61-Ruzzo2019 G
CENPJ     iHART2623chr13:
25478198-25478198
TAsplicingMaternalsplicing16.61-Ruzzo2019 G
CENPJ     2-1275-003chr13:
25460859-25460859
TCintronicDe novo--Trost2022 G
Yuen2017 G
CENPJ     Li2017:20632chr13:
25486753-25486754
AGAexonicUnknownframeshift deletionNM_018451c.410delCp.A137fs--Li2017 T
CENPJ     MSSNG00014-003chr13:
25475624-25475624
TCintronicDe novo--Trost2022 G
CENPJ     Li2017:10chr13:
25480954-25480955
CGCexonicUnknownframeshift deletionNM_018451c.1221delCp.S407fs--Li2017 T
CENPJ     iHART2912chr13:
25480590-25480590
GCexonicMaternalstopgainNM_018451c.C1586Gp.S529X17.254.978E-5Ruzzo2019 G
CENPJ     AU2320301chr13:
25476447-25476447
ACintronicDe novo--Trost2022 G
CENPJ     SP0017364chr13:
25457519-25457519
ATintronicDe novo-5.028E-5Trost2022 G
CENPJ     MSSNG00373-003chr13:
25469126-25469126
GAintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More