
Results for "ITGB6"

Variant Events: 22

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
ITGB6     SP0134333chr2:
TAAGTintronicDe novo--Fu2022 E
ITGB6     REACH000514chr2:
TCintronicDe novo--Trost2022 G
ITGB6     1-0380-003chr2:
TCintronicDe novo--Trost2022 G
Yuen2017 G
ITGB6     152-HSC0079chr2:
CTexonicInheritednonsynonymous SNVNM_001282354
25.59.065E-5Patowary2019 E
ITGB6     1-1135-003chr2:
GAintronicDe novo--Trost2022 G
ITGB6     MSSNG00355-004chr2:
TCintronicDe novo--Trost2022 G
ITGB6     AU3862305chr2:
ATintergenicDe novo--Yuen2017 G
ITGB6     SP0000087chr2:
CTexonicDe novononsynonymous SNVNM_001282354
14.272.5E-5Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
ITGB6     MSSNG00032-004chr2:
TAintronicDe novo--Trost2022 G
ITGB6     7902-01-001chr2:
GAexonicDe novosynonymous SNVNM_001282354
--Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ITGB6     5-0072-003chr2:
CTintronicDe novo--Trost2022 G
ITGB6     1-1174-003chr2:
TCintronicDe novo--Trost2022 G
ITGB6     MSSNG00021-004chr2:
CTintronicDe novo--Trost2022 G
ITGB6     3-0322-000chr2:
TAATTAAGAAAACCAAACATintronicDe novo--Trost2022 G
ITGB6     2-1440-003chr2:
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
ITGB6     SP0208170chr2:
CAintronicDe novo-3.311E-5Trost2022 G
ITGB6     A7chr2:
GAexonicDe novostopgainNM_001282354
40.01.648E-5Wu2018 G
ITGB6     A3chr2:
CGsplicingDe novosplicing27.0-Wu2018 G
ITGB6     AU059903chr2:
CAAGGAAGCAAGintergenicDe novo--Yuen2017 G
ITGB6     AU3724302chr2:
GTintronicDe novo--Trost2022 G
Yuen2017 G
ITGB6     1-0125-003chr2:
GCintronicDe novo--Trost2022 G
Yuen2017 G
ITGB6     5-0018-003chr2:
GCintergenicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView