or
or
Exact

Results for "ADARB2"

Variant Events: 113

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADARB2     5-0109-003chr10:
1515145-1515145
AGintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     PN400305chr10:
1284303-1284303
CTexonicUnknownnonsynonymous SNVNM_018702c.G1252Ap.G418S36.00.0077Leblond2019 E
ADARB2     2-1352-003chr10:
1678487-1678487
GAintronicDe novo--Yuen2016 G
Yuen2017 G
ADARB2     2-1176-003chr10:
1628545-1628545
AAGTGCTTintronicDe novo--Yuen2017 G
ADARB2     2-1267-003chr10:
1275622-1275622
GGCintronicDe novo--Trost2022 G
ADARB2     6-0476-003chr10:
1291643-1291643
AATintronicDe novo--Trost2022 G
ADARB2     MSSNG00369-003chr10:
1235991-1235991
CGintronicDe novo--Trost2022 G
ADARB2     MSSNG00133-003chr10:
1255778-1255778
CTintronicDe novo--Trost2022 G
ADARB2     5-5011-003chr10:
1235609-1235609
GAintronicDe novo--Trost2022 G
ADARB2     MT_151.4chr10:
1367978-1367978
CAintronicDe novo--Trost2022 G
ADARB2     1-0546-003chr10:
1382925-1382925
AGintronicDe novo--Trost2022 G
ADARB2     PN400512chr10:
1284303-1284303
CTexonicUnknownnonsynonymous SNVNM_018702c.G1252Ap.G418S36.00.0077Leblond2019 E
ADARB2     AU059003chr10:
1322967-1322967
GAintronicDe novo--Trost2022 G
ADARB2     REACH000364chr10:
1358111-1358111
AGintronicDe novo--Trost2022 G
ADARB2     MSSNG00103-004chr10:
1321081-1321081
GAintronicDe novo--Trost2022 G
ADARB2     MSSNG00410-003chr10:
1322595-1322597
CATCintronicDe novo--Trost2022 G
ADARB2     4-0028-003chr10:
1313426-1313426
GAintronicDe novo--Trost2022 G
ADARB2     AU2283301chr10:
1320710-1320710
ATintronicDe novo--Trost2022 G
ADARB2     1-0213-004chr10:
1451473-1451473
GAintronicDe novo--Trost2022 G
ADARB2     2-0122-004chr10:
1668403-1668403
CTintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     2-1364-003chr10:
1924748-1924748
CTintergenicDe novo--Yuen2017 G
ADARB2     SP0005166chr10:
1246095-1246095
GTintronicDe novo3.591-Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
ADARB2     1-0213-004chr10:
1451475-1451475
CTintronicDe novo--Trost2022 G
ADARB2     AU4173301chr10:
1381502-1381502
GCintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     MSSNG00084-003chr10:
1410027-1410027
CTintronicDe novo--Trost2022 G
ADARB2     1-0175-003chr10:
1412031-1412032
TCATintronicDe novo--Trost2022 G
ADARB2     MSSNG00439-003chr10:
1391742-1391742
CTintronicDe novo--Trost2022 G
ADARB2     MSSNG00390-003chr10:
1404850-1404850
GAintronicDe novo--Trost2022 G
ADARB2     2-1477-003chr10:
1383625-1383625
CTintronicDe novo--Trost2022 G
ADARB2     4-0019-003chr10:
1390112-1390118
GACAGACGintronicDe novo--Trost2022 G
ADARB2     2-1093-009chr10:
1525896-1525905
AGCAACTAATCTCTCCCGAGAintronicDe novo--Trost2022 G
ADARB2     4-0046-003chr10:
1525914-1525915
ATCACAAAAGCCCCCCCAACCCCGGAACintronicDe novo--Trost2022 G
ADARB2     10-0008-003chr10:
1477042-1477042
ACintronicDe novo--Trost2022 G
ADARB2     3-0533-000chr10:
1516741-1516741
CTintronicDe novo--Trost2022 G
ADARB2     MT_70.3chr10:
1470817-1470817
AGintronicDe novo--Trost2022 G
ADARB2     MSSNG00432-003chr10:
1474104-1474104
ACintronicDe novo--Trost2022 G
ADARB2     1-0664-003Achr10:
1451875-1451875
GAintronicDe novo--Trost2022 G
ADARB2     3-0548-000chr10:
1458911-1458911
AGintronicDe novo--Trost2022 G
ADARB2     2-1772-003chr10:
1558627-1558627
CTintronicDe novo--Trost2022 G
ADARB2     EGAN00001101020chr10:
1233756-1233756
TGintronicDe novo--Satterstrom2020 E
Trost2022 G
ADARB2     MSSNG00245-003chr10:
1530639-1530639
GAintronicDe novo--Trost2022 G
ADARB2     MT_166.3chr10:
1550136-1550136
TCintronicDe novo--Trost2022 G
ADARB2     1-0346-004chr10:
1525926-1525926
AAGCCACintronicDe novo--Trost2022 G
ADARB2     MT_87.3chr10:
1527333-1527333
GAintronicDe novo--Trost2022 G
ADARB2     1-0346-004chr10:
1525921-1525924
GGTTAAAAintronicDe novo--Trost2022 G
ADARB2     1-0571-003chr10:
2043203-2043203
AGintergenicDe novo--Yuen2017 G
ADARB2     2-1535-003chr10:
1525921-1525924
GGTTAAAAintronicDe novo--Trost2022 G
ADARB2     AU056005chr10:
1619570-1619570
AGintronicDe novo--Trost2022 G
ADARB2     MSSNG00371-003chr10:
1621715-1621715
CTintronicDe novo--Trost2022 G
ADARB2     2-1299-003chr10:
1650584-1650584
GCintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     2-0102-004chr10:
1614424-1614425
AGGTintronicDe novo--Trost2022 G
ADARB2     1-0330-004chr10:
1617222-1617222
AAGGGCTGCAACATTGTAACAGGTAACTintronicDe novo--Trost2022 G
ADARB2     13616.p1chr10:
1405639-1405639
CTexonicnonsynonymous SNVNM_018702c.G661Ap.D221N17.57-Zhou2022 GE
ADARB2     REACH000214chr10:
1608285-1608285
ACintronicDe novo--Trost2022 G
ADARB2     MSSNG00407-003chr10:
1610708-1610709
TATintronicDe novo--Trost2022 G
ADARB2     PN400441chr10:
1284303-1284303
CTexonicUnknownnonsynonymous SNVNM_018702c.G1252Ap.G418S36.00.0077Leblond2019 E
ADARB2     2-1196-003chr10:
1695793-1695793
CAintronicDe novo--Trost2022 G
ADARB2     MSSNG00084-003chr10:
1696672-1696672
GAintronicDe novo--Trost2022 G
ADARB2     2-1429-003chr10:
1519049-1519049
CGintronicDe novo--Yuen2017 G
ADARB2     3-0663-000chr10:
1654459-1654459
CTintronicDe novo--Trost2022 G
ADARB2     AU3727303chr10:
1266183-1266197
ATGGTGGTGGTGGTGATGGTGGTGGTGintronicDe novo--Yuen2017 G
ADARB2     AU3913302chr10:
1659160-1659160
GTintronicDe novo--Trost2022 G
ADARB2     REACH000409chr10:
1635650-1635650
CTintronicDe novo--Trost2022 G
ADARB2     MT_75.3chr10:
1651831-1651831
CTintronicDe novo--Trost2022 G
ADARB2     4-0077-003chr10:
1624406-1624406
TTTGGAGCintronicDe novo--Trost2022 G
ADARB2     1-0338-005chr10:
1671192-1671192
AGintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     AU4129303chr10:
1634455-1634455
GAintronicDe novo--Trost2022 G
ADARB2     1-1008-003chr10:
1741414-1741414
AGintronicDe novo--Trost2022 G
ADARB2     1-0458-005chr10:
1753056-1753057
GACCintronicDe novo--Trost2022 G
ADARB2     7-0287-003chr10:
1735745-1735745
CTintronicDe novo--Trost2022 G
ADARB2     AU046703chr10:
1736963-1736963
GCintronicDe novo--Trost2022 G
ADARB2     SP0136053chr10:
1717689-1717689
TAintronicDe novo--Trost2022 G
ADARB2     1-0994-003chr10:
1372887-1372887
CTintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     SP0179610chr10:
1720400-1720400
GTintronicDe novo--Trost2022 G
ADARB2     D4S2Z-01chr10:
1713515-1713515
GAintronicDe novo--Trost2022 G
ADARB2     SP0065249chr10:
1717689-1717689
TAintronicDe novo--Trost2022 G
ADARB2     74-0765chr10:
1405594-1405594
GAexonicInheritednonsynonymous SNVNM_018702c.C706Tp.L236F0.0080.0026Patowary2019 E
ADARB2     7-0094-003chr10:
1764779-1764779
GAintronicDe novo--Trost2022 G
ADARB2     1-0458-005chr10:
1753060-1753060
ATintronicDe novo--Trost2022 G
ADARB2     SJD_65.3chr10:
1759015-1759015
CAintronicDe novo--Trost2022 G
ADARB2     1-0253-005chr10:
1736518-1736518
GAintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     AU046703chr10:
1744758-1744758
GCintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     2-0171-003chr10:
1252479-1252479
GAintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     1-0148-005chr10:
1829153-1829153
GCintergenicDe novo--Yuen2017 G
ADARB2     1-0972-003chr10:
1442362-1442362
CTintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     AU3761301chr10:
1890046-1890046
GTintergenicDe novo--Yuen2017 G
ADARB2     2-1085-003chr10:
1370155-1370155
CCAGCTintronicDe novo--Yuen2017 G
ADARB2     2-0006-003chr10:
1923637-1923637
GCintergenicDe novo--Yuen2017 G
ADARB2     2-1357-003chr10:
1275618-1275618
AACGTTintronicDe novo--Yuen2017 G
ADARB2     1-0051-004chr10:
1759747-1759747
CAintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     2-1315-003chr10:
1901883-1901883
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
ADARB2     1-0197-003chr10:
1568115-1568117
CGTCintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     2-0070-003chr10:
1395204-1395204
ATintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     AU3725302chr10:
1333608-1333608
GTintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     1-0389-004chr10:
1696571-1696571
GAintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     7-0078-003chr10:
2040608-2040608
TGintergenicDe novo--Yuen2017 G
ADARB2     AU3057301chr10:
1508531-1508531
GAintronicDe novo--Yuen2017 G
ADARB2     2-1619-003chr10:
1917854-1917854
ACintergenicDe novo--Yuen2017 G
ADARB2     1-0638-003chr10:
1653340-1653340
CTintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     2-0285-003chr10:
1275598-1275598
GGTGTGTAintronicDe novo--Yuen2017 G
ADARB2     2-1363-003chr10:
2005956-2005956
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
ADARB2     AU076808chr10:
1888048-1888048
ACintergenicDe novo--Yuen2017 G
ADARB2     1-0044-003chr10:
1465090-1465090
ATintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     2-0122-003chr10:
1619891-1619891
GAintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     AU1987304chr10:
1393301-1393301
CTintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     1-0246-005chr10:
1275618-1275618
AACGTTintronicDe novo--Yuen2017 G
ADARB2     2-0210-004chr10:
1628886-1628886
AGintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     2-0210-004chr10:
1278687-1278694
TGTATGTGTintronicDe novo--Yuen2017 G
ADARB2     AU079605chr10:
1302869-1302869
GAintronicDe novo--Yuen2017 G
ADARB2     1-0338-003chr10:
1671192-1671192
AGintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     1-0324-003chr10:
1498362-1498362
CTintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     2-1497-003chr10:
1520327-1520327
AGintronicDe novo--Trost2022 G
Yuen2017 G
ADARB2     5-0123-003chr10:
1497004-1497004
CGintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More