Variant Results

or

or

Results for "ZBTB5"

Variant Events: 10

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
ZBTB5	1-0265-004	chr9: 37484073-37484073	T	TCTTCTTTCTTCTTTCTTCATC	intergenic		De novo					-	-	Yuen2017 G
ZBTB5	2-1261-004	chr9: 37467210-37467210	C	CTTA	intergenic		De novo					-	-	Yuen2017 G
ZBTB5	2-1646-003	chr9: 37467212-37467218	GTCTCTC	GTCTCTCTCTC	intergenic		De novo					-	-	Yuen2017 G
ZBTB5	AU4467302	chr9: 37479685-37479685	G	A	intergenic		De novo					-	-	Yuen2017 G
ZBTB5	G01-GEA-14-HI	chr9: 37441320-37441320	G	A	exonic		De novo	nonsynonymous SNV	NM_014872	c.C1229T	p.S410L	18.96	8.267E-6	Fu2022 E Lim2017 E Satterstrom2020 E
ZBTB5	A1443B	chr9: 37440562-37440562	T	C	exonic		De novo	nonsynonymous SNV	NM_014872	c.A1987G	p.T663A	28.0	-	Fu2022 E
ZBTB5	PN400195	chr9: 37442167-37442167	G	C	exonic		De novo	nonsynonymous SNV	NM_014872	c.C382G	p.P128A	16.31	8.256E-6	Leblond2019 E
ZBTB5	1-0144-005	chr9: 37438634-37438634	G	A	UTR3		De novo					-	-	Yuen2017 G
ZBTB5	AU2793301	chr9: 37448160-37448160	A	T	intronic		De novo					-	-	Yuen2017 G
ZBTB5	A9	chr9: 37482276-37482276	G	A	intergenic		De novo					-	-	Wu2018 G

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More