or
or
Exact

Results for "CHD3"

Variant Events: 18

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CHD3     G01-GEA-76-HIchr17:
7797451-7797451
GAexonicDe novononsynonymous SNVNM_001005271
NM_001005273
NM_005852
c.G1120A
c.G943A
c.G943A
p.E374K
p.E315K
p.E315K
14.022.481E-5Fu2022 E
Lim2017 E
Satterstrom2020 E
CHD3     2-1511-003chr17:
7801856-7801871
TAAGAAGAAGAAGAAGTAAGAAGAAGAAGexonicDe novononframeshift deletionNM_001005271
NM_001005273
NM_005852
c.2284_2286del
c.2107_2109del
c.2107_2109del
p.762_762del
p.703_703del
p.703_703del
--Yuen2017 G
CHD3     5-0077-004chr17:
7806567-7806567
GAintronicDe novo-1.679E-5Yuen2017 G
CHD3     SSC05373chr17:
7812028-7812028
CTexonicnonsynonymous SNVNM_005852
NM_001005271
NM_001005273
c.C5173T
c.C5452T
c.C5275T
p.R1725W
p.R1818W
p.R1759W
17.3-Antaki2022 GE
CHD3     6302chr17:
7812028-7812028
CTexonicDe novononsynonymous SNVNM_005852
NM_001005271
NM_001005273
c.C5173T
c.C5452T
c.C5275T
p.R1725W
p.R1818W
p.R1759W
17.3-Fu2022 E
CHD3     iHART2931chr17:
7806007-7806007
CTexonicDe novononsynonymous SNVNM_001005271
NM_001005273
NM_005852
c.C3509T
c.C3332T
c.C3332T
p.T1170M
p.T1111M
p.T1111M
17.15-Ruzzo2019 G
CHD3     SP0000124chr17:
7798772-7798772
GAexonicDe novononsynonymous SNVNM_001005271
NM_001005273
NM_005852
c.G1796A
c.G1619A
c.G1619A
p.R599H
p.R540H
p.R540H
14.23.295E-5Feliciano2019 E
Fu2022 E
CHD3     1-1000-003chr17:
7788731-7788748
GGGAGGAGGAGGAGGAGGGGGAGGAGGAGGAGGintronicDe novo--Yuen2017 G
CHD3     12630.p1chr17:
7812028-7812028
CTexonicDe novononsynonymous SNVNM_005852
NM_001005271
NM_001005273
c.C5173T
c.C5452T
c.C5275T
p.R1725W
p.R1818W
p.R1759W
17.3-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
CHD3     SP0027448chr17:
7809304-7809308
TTAAGTexonicDe novononframeshift deletionNM_001005271
NM_001005273
NM_005852
c.4533_4535del
c.4356_4358del
c.4356_4358del
p.1511_1512del
p.1452_1453del
p.1452_1453del
--Feliciano2019 E
Fu2022 E
CHD3     SP0091005chr17:
7806475-7806475
TGintronicDe novo--Fu2022 E
CHD3     SP0077788chr17:
7802464-7802464
ATexonicDe novononsynonymous SNVNM_001005271
NM_001005273
NM_005852
c.A2464T
c.A2287T
c.A2287T
p.M822L
p.M763L
p.M763L
14.44-Fu2022 E
CHD3     DEASD_0257_001chr17:
7811315-7811315
TCexonicDe novosynonymous SNVNM_005852
NM_001005271
NM_001005273
c.T5028C
c.T5307C
c.T5130C
p.N1676N
p.N1769N
p.N1710N
--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
CHD3     2-1154-003chr17:
7803650-7803650
CGexonicDe novononsynonymous SNVNM_001005271
NM_001005273
NM_005852
c.C2902G
c.C2725G
c.C2725G
p.L968V
p.L909V
p.L909V
12.28-Yuen2016 G
Yuen2017 G
CHD3     SP0016344chr17:
7806608-7806608
CTexonicDe novononsynonymous SNVNM_001005271
NM_001005273
NM_005852
c.C3691T
c.C3514T
c.C3514T
p.R1231W
p.R1172W
p.R1172W
20.5-Antaki2022 GE
Fu2022 E
CHD3     13322.p1chr17:
7803837-7803837
CCTintronicDe novo--Satterstrom2020 E
CHD3     SP0024057chr17:
7804025-7804025
GAexonicDe novononsynonymous SNVNM_001005271
NM_001005273
NM_005852
c.G3131A
c.G2954A
c.G2954A
p.R1044Q
p.R985Q
p.R985Q
19.34-Antaki2022 GE
Fu2022 E
CHD3     M03573chr17:
7814871-7814871
CTexonicUnknownstopgainNM_005852
NM_001005271
NM_001005273
c.C5869T
c.C6148T
c.C5971T
p.R1957X
p.R2050X
p.R1991X
44.0-Guo2018 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More