
Results for "Stessman2017"

Variant Events: 732

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
SYNGAP1     08C77304chr6:
CTexonicUnknownnonsynonymous SNVNM_006772c.C3055Tp.R1019C16.893.303E-5Stessman2017 T
SIN3A     08C77304chr15:
GAexonicInheritednonsynonymous SNVNM_001145357
36.0-Stessman2017 T
AGAP2     08C73792chr12:
CGexonicUnknownnonsynonymous SNVNM_014770
23.0-Stessman2017 T
PARD3B     08C74095chr2:
CTexonicUnknownnonsynonymous SNVNM_152526
22.1-Stessman2017 T
RELN     09C81884chr7:
CTexonicDe novononsynonymous SNVNM_005045
34.0-Stessman2017 T
Stessman2017 T
SETD5     09C82351chr3:
CTexonicUnknownnonsynonymous SNVNM_001080517
28.52.484E-5Stessman2017 T
RIMBP2     09C80376chr12:
GAexonicUnknownnonsynonymous SNVNM_015347c.C2245Tp.R749W21.61.653E-5Stessman2017 T
CHD2     09C80382chr15:
GAexonicDe novononsynonymous SNVNM_001271c.G2699Ap.R900Q36.0-Stessman2017 T
Stessman2017 T
SMARCC2     09C82996chr12:
34.0-Stessman2017 T
SPAST     09C88948chr2:
AGexonicUnknownnonsynonymous SNVNM_199436
26.6-Stessman2017 T
SETD5     09C82352chr3:
CTexonicUnknownnonsynonymous SNVNM_001080517
28.52.484E-5Stessman2017 T
PIK3CA     09C82723chr3:
CTexonicUnknownnonsynonymous SNVNM_006218c.C1346Tp.P449L28.6-Stessman2017 T
MED13L     09C91528chr12:
CAexonicDe novostopgainNM_015335c.G2746Tp.E916X43.0-Stessman2017 T
Stessman2017 T
RIMS1     09C95446chr6:
CGexonicUnknownnonsynonymous SNVNM_001168411
18.518.287E-6Stessman2017 T
ARID1B     09C90171chr6:
GAexonicUnknownnonsynonymous SNVNM_017519
18.981.878E-5Stessman2017 T
KMT2C     09C90854chr7:
GAexonicInheritedstopgainNM_170606c.C9451Tp.Q3151X51.0-Stessman2017 T
ANK2     09C95600chr4:
CTexonicUnknownnonsynonymous SNVNM_001148
22.48.267E-6Stessman2017 T
TRIP12     AU002403chr2:
GAexonicDe novostopgainNM_001284216
46.0-Stessman2017 T
Stessman2017 T
RIMS1     09C95447chr6:
CGexonicUnknownnonsynonymous SNVNM_001168411
18.518.287E-6Stessman2017 T
KMT2A     09C95599chr11:
GCexonicUnknownnonsynonymous SNVNM_001197104
21.3-Stessman2017 T
PTK7     AU005303chr6:
GTexonicUnknownnonsynonymous SNVNM_001270398
27.1-Stessman2017 T
DOCK8     M08458chr9:
TCsplicingDe novosplicing25.2-Stessman2017 T
KMT2C     AU009503chr7:
CTexonicUnknownnonsynonymous SNVNM_170606c.G4442Ap.R1481Q24.81.648E-5Stessman2017 T
CUL7     AU002804chr6:
AGexonicUnknownnonsynonymous SNVNM_001168370
24.1-Stessman2017 T
UNC80     AU005213chr2:
GAexonicUnknownnonsynonymous SNVNM_032504
29.54.406E-5Stessman2017 T
CHD2     AU015203chr15:
CTexonicUnknownnonsynonymous SNVNM_001271c.C5362Tp.R1788C20.72.484E-5Stessman2017 T
NAV2     AU016403chr11:
CTexonicUnknownnonsynonymous SNVNM_001111018
19.085.001E-5Stessman2017 T
NBEA     AU011604chr13:
CTexonicUnknownnonsynonymous SNVNM_015678c.C2596Tp.R866C25.11.628E-5Stessman2017 T
SETD5     AU011704chr3:
GAexonicPaternalnonsynonymous SNVNM_001080517
34.08.54E-6Stessman2017 T
PLXNA3     AU018803chrX:
CTexonicUnknownnonsynonymous SNVNM_017514c.C1297Tp.R433C22.53.703E-5Stessman2017 T
PASK     AU019303chr2:
AAAAAexonicInheritedframeshift insertionNM_001252119
--Stessman2017 T
HECTD1     AU016504chr14:
GAexonicInheritednonsynonymous SNVNM_015382c.C2396Tp.S799L35.01.658E-5Stessman2017 T
SPAST     AU018604chr2:
CTexonicUnknownnonsynonymous SNVNM_014946
26.16.644E-5Stessman2017 T
AGAP2     AU024104chr12:
CTexonicInheritednonsynonymous SNVNM_001122772
35.04.119E-5Stessman2017 T
CUL7     AU024204chr6:
GAexonicUnknownnonsynonymous SNVNM_001168370
26.01.738E-5Stessman2017 T
GLI2     AU021503chr2:
GAexonicUnknownnonsynonymous SNVNM_005270c.G1381Ap.E461K20.8-Stessman2017 T
MYH9     AU022704chr22:
CTexonicInheritednonsynonymous SNVNM_002473c.G2194Ap.G732S35.0-Stessman2017 T
VCP     AU030504chr9:
CAexonicUnknownnonsynonymous SNVNM_007126c.G1477Tp.V493F25.5-Stessman2017 T
GRIN2B     AU030703chr12:
CAexonicUnknownnonsynonymous SNVNM_000834c.G286Tp.G96W24.5-Stessman2017 T
SCN2A     AU024703chr2:
CTexonicUnknownnonsynonymous SNVNM_001040143
15.374.128E-5Stessman2017 T
CDC45     AU025506chr22:
CTexonicInheritednonsynonymous SNVNM_001178011
34.0-Stessman2017 T
HECTD1     AU031104chr14:
TTTTTTCTTTTTTTCexonicInheritedframeshift insertionNM_015382c.2485dupAp.T829fs--Stessman2017 T
CHD8     AU0316301chr14:
TAAexonicDe novoframeshift deletionNM_001170629
--Stessman2017 T
Stessman2017 T
NAA15     AU031003chr4:
ACAAexonicDe novoframeshift deletionNM_057175c.530_531delp.T177fs--Stessman2017 T
Stessman2017 T
SRCAP       AU031104chr16:
CTexonicUnknownstopgainNM_006662c.C9121Tp.R3041X47.0-Stessman2017 T
NEMF     AU038004chr14:
CAexonicUnknownnonsynonymous SNVNM_001301732
22.4-Stessman2017 T
PHF7     AU050703chr3:
CCAGCCACsplicingInheritedsplicing16.91-Stessman2017 T
MECP2     AU034904chrX:
37.0-Stessman2017 T
DLGAP1     AU035604chr18:
GCexonicUnknownnonsynonymous SNVNM_001003809
23.7-Stessman2017 T
ARID1B     AU053503chr6:
GTexonicUnknownnonsynonymous SNVNM_017519
18.25-Stessman2017 T
PASK     AU054103chr2:
TCGATCexonicPaternalframeshift substitutionNM_001252119
--Stessman2017 T
SIN3A     AU052103chr15:
CTexonicUnknownnonsynonymous SNVNM_001145357
37.0-Stessman2017 T
RELN     AU0531302chr7:
GAexonicDe novostopgainNM_005045
45.0-Stessman2017 T
Stessman2017 T
IQGAP3     AU059903chr1:
GAexonicUnknownnonsynonymous SNVNM_178229c.C409Tp.R137W22.95.765E-5Stessman2017 T
NRXN1     AU061104chr2:
ACAAexonicInheritedframeshift deletionNM_004801
--Stessman2017 T
EPHB2     AU057904chr1:
ATexonicUnknownnonsynonymous SNVNM_001309192
26.7-Stessman2017 T
WAC     AU057904chr10:
GAexonicUnknownnonsynonymous SNVNM_016628
36.0-Stessman2017 T
PTPN11     AU066404chr12:
GAexonicUnknownnonsynonymous SNVNM_002834c.G1508Ap.G503E34.0-Stessman2017 T
SHANK2     AU071703chr11:
CTexonicUnknownunknown24.64.601E-5Stessman2017 T
FAM8A1     AU062003chr6:
CCCCCAGGCCGAACCCCCCAGGCTTAACexonicInheritednonframeshift substitutionNM_016255c.135_136TTN/A--Stessman2017 T
LAMC3     AU062203chr9:
CTexonicPaternalstopgainNM_006059c.C1648Tp.Q550X37.0-Stessman2017 T
CDC42BPB     AU079605chr14:
TTTCTTexonicInheritedframeshift deletionNM_006035c.1455_1458delp.K485fs--Stessman2017 T
SVIL     AU080103 Complex Event; expand row to view variants  Maternalnonsynonymous SNV, stopgainNM_003174
45.08.237E-5Stessman2017 T
Stessman2017 T
KATNAL2     AU071803chr18:
GAsplicingMaternalsplicing20.5-Stessman2017 T
MYT1L     AU074503chr2:
TCAATTexonicUnknownframeshift deletionNM_001303052
--Stessman2017 T
HDAC9     AU081104chr7:
CTexonicUnknownnonsynonymous SNVNM_058176
26.68.283E-6Stessman2017 T
DHX9     AU082104chr1:
CTexonicUnknownnonsynonymous SNVNM_001357c.C3152Tp.T1051I27.2-Stessman2017 T
DLG2     AU080203chr11:
TGTTintronicMaternal--Stessman2017 T
ALDH5A1     AU080403chr6:
GAexonicPaternalnonsynonymous SNVNM_001080
35.0-Stessman2017 T
AGO4     AU083003chr1:
GAexonicPaternalnonsynonymous SNVNM_017629c.G1847Ap.R616Q36.08.245E-6Stessman2017 T
CACNA2D3     AU0863301chr3:
GAexonicUnknownnonsynonymous SNVNM_018398c.G2167Ap.V723M23.71.658E-5Stessman2017 T
AHNAK     AU083003chr11:
CTexonicUnknownnonsynonymous SNVNM_001620c.G17336Ap.R5779H18.319.084E-5Stessman2017 T
ZBTB45     AU083003chr19:
GAexonicUnknownnonsynonymous SNVNM_001316978
19.1-Stessman2017 T
SCN2A     AU0918301chr2:
CTTexonicDe novoframeshift deletionNM_001040143
--Stessman2017 T
Stessman2017 T
NAV2     AU0922301chr11:
CTexonicUnknownnonsynonymous SNVNM_001111019
20.62.474E-5Stessman2017 T
CSMD1     AU0864301chr8:
AGsplicingInheritedsplicing22.5-Stessman2017 T
RELN     AU0903301chr7:
GAexonicDe novostopgainNM_005045
49.0-Stessman2017 T
Stessman2017 T
CTTNBP2     AU1067302chr7:
GAexonicUnknownnonsynonymous SNVNM_033427c.C124Tp.R42W23.61.0E-4Stessman2017 T
DLGAP1     AU1078301chr18:
CTsplicingInheritedsplicing15.7-Stessman2017 T
ERBIN     AU0959302chr5:
36.0-Stessman2017 T
MKI67     M21670chr10:
TGTTexonicMaternalframeshift deletionNM_001145966
--Stessman2017 T
KMT2C     AU1067302chr7:
GAexonicUnknownnonsynonymous SNVNM_170606c.C11590Tp.R3864C19.711.647E-5Stessman2017 T
GLI2     AU1107301chr2:
GAexonicInheritednonsynonymous SNVNM_005270c.G686Ap.R229H35.01.659E-5Stessman2017 T
ANP32A     AU1196301chr15:
CGexonicUnknownnonsynonymous SNVNM_006305c.G616Cp.E206Q15.294.487E-5Stessman2017 T
MKI67     M23639chr10:
CAAexonicPaternalframeshift deletionNM_002417c.1021delGp.E341fs--Stessman2017 T
KAT2B     AU1087301chr3:
TTTTexonicInheritedframeshift deletionNM_003884c.683_684delp.F228fs--Stessman2017 T
CDC42BPB     AU1097302chr14:
CTexonicUnknownnonsynonymous SNVNM_006035c.G822Ap.M274I32.08.27E-6Stessman2017 T
SCN1A     AU1209302chr2:
GAexonicUnknownnonsynonymous SNVNM_001165963
29.93.295E-5Stessman2017 T
PTK7     AU1220301chr6:
CTexonicUnknownnonsynonymous SNVNM_001270398
19.84-Stessman2017 T
LHX1     AU1196301chr17:
GCexonicMaternalnonsynonymous SNVNM_005568c.G517Cp.D173H33.0-Stessman2017 T
STXBP5     AU1207301chr6:
CTexonicUnknownnonsynonymous SNVNM_139244
19.061.655E-5Stessman2017 T
CACNA2D3     AU1271303chr3:
GAexonicMaternalnonsynonymous SNVNM_018398c.G1163Ap.R388Q34.01.09E-5Stessman2017 T
ANK2     AU1272301chr4:
CTexonicUnknownnonsynonymous SNVNM_001148c.C5806Tp.R1936C17.391.649E-5Stessman2017 T
ASXL3     AU1244301chr18:
GAsplicingInheritedsplicing15.16-Stessman2017 T
AGAP2     AU1254301chr12:
CTexonicInheritednonsynonymous SNVNM_001122772
35.04.172E-5Stessman2017 T
CTNND2     AU1352302chr5:
CTexonicPaternalnonsynonymous SNVNM_001288716
32.0-Stessman2017 T
RANBP2     AU1374302chr2:
TAexonicUnknownnonsynonymous SNVNM_006267c.T7895Ap.V2632D23.71.652E-5Stessman2017 T
ARHGAP32     AU1339302chr11:
CTexonicUnknownnonsynonymous SNVNM_014715
21.22.471E-5Stessman2017 T
DSCAM     AU1350302chr21:
CTexonicMaternalnonsynonymous SNVNM_001271534
35.0-Stessman2017 T
KMT2A     AU1391302chr11:
GAexonicUnknownnonsynonymous SNVNM_001197104
26.8-Stessman2017 T
NAV2     AU1400301chr11:
CAexonicUnknownnonsynonymous SNVNM_001111018
27.2-Stessman2017 T
LAMC3     AU1377302chr9:
GAexonicPaternalnonsynonymous SNVNM_006059c.G1045Ap.G349S35.0-Stessman2017 T
LAMC3     AU1390302chr9:
CTexonicUnknownnonsynonymous SNVNM_006059c.C1240Tp.R414C19.322.493E-5Stessman2017 T
DNAJC6     AU1453302chr1:
GCGGCGCGexonicInheritedframeshift insertionNM_001256864
--Stessman2017 T
DHX9     AU1459301chr1:
CTexonicDe novostopgainNM_001357c.C421Tp.R141X21.3-Stessman2017 T
Stessman2017 T
UNC80     AU1423304chr2:
GAexonicUnknownnonsynonymous SNVNM_032504
22.1-Stessman2017 T
CTTNBP2     AU1446301chr7:
ACexonicMaternalstopgainNM_033427c.T3360Gp.Y1120X37.0-Stessman2017 T
CDC42BPB     AU1522303chr14:
GAexonicUnknownnonsynonymous SNVNM_006035c.C1294Tp.R432W22.6-Stessman2017 T
CSMD1     AU1573301chr8:
GAexonicUnknownnonsynonymous SNVNM_033225c.C8131Tp.R2711W15.95.798E-5Stessman2017 T
DIP2A     AU1497302chr21:
CAexonicUnknownnonsynonymous SNVNM_001146116
26.9-Stessman2017 T
NEMF     AU1499301chr14:
CTexonicMaternalnonsynonymous SNVNM_001301732
36.05.769E-5Stessman2017 T
ARHGAP32     AU1699302chr11:
GAexonicUnknownnonsynonymous SNVNM_014715
25.41.648E-5Stessman2017 T
TRIO     AU1835302chr5:
GTTexonicMaternalframeshift deletionNM_007118c.6400delGp.V2134fs--Stessman2017 T
PTK7     AU1576302chr6:
CTexonicUnknownnonsynonymous SNVNM_001270398
25.14.136E-5Stessman2017 T
PTK7     AU1685301chr6:
CCCCCGCCCCGexonicInheritedframeshift deletionNM_001270398
--Stessman2017 T
KMT2C     AU1885302chr7:
GTTexonicInheritedframeshift deletionNM_170606c.1499delCp.T500fs--Stessman2017 T
AGO4     AU1941302chr1:
CTexonicPaternalstopgainNM_017629c.C808Tp.R270X38.0-Stessman2017 T
CAPRIN1     AU1840305chr11:
CTexonicUnknownnonsynonymous SNVNM_005898
17.24-Stessman2017 T
RELN     AU1885302chr7:
CTexonicUnknownnonsynonymous SNVNM_005045
23.4-Stessman2017 T
SMARCC2     AU2554301chr12:
34.0-Stessman2017 T
TNRC6B     AU2689306chr22:
GGGGGGAGGGGGGGAexonicDe novoframeshift insertionNM_015088
--Stessman2017 T
Stessman2017 T
NISCH     AU2004302chr3:
GAexonicMaternalnonsynonymous SNVNM_001276293
34.0-Stessman2017 T
MAP3K1     M20294chr5:
ACAACexonicMaternalframeshift insertionNM_005921c.1369dupAp.L456fs--Stessman2017 T
WDFY3     AU2182302chr4:
CTexonicInheritedstopgainNM_014991c.G3789Ap.W1263X46.0-Stessman2017 T
AHNAK     M17634chr11:
TTTexonicMaternalframeshift deletionNM_001620c.13579delAp.N4527fs--Stessman2017 T
SRCAP       AU3142302chr16:
ACGGAACGGACGGAexonicInheritedframeshift insertionNM_006662c.6511_6512insCGGAp.T2171fs--Stessman2017 T
AHNAK     M20684chr11:
CTCTCTTCTCTTexonicMaternalframeshift deletionNM_001620c.17363_17364delp.E5788fs--Stessman2017 T
ADGRL2     101443-100chr1:
TAsplicingInheritedsplicing--Stessman2017 T
AHNAK     M20567chr11:
AGAAexonicMaternalframeshift deletionNM_001620c.16810_16811delp.S5604fs--Stessman2017 T
CHD7     AU2835301chr8:
CTexonicUnknownnonsynonymous SNVNM_017780c.C5926Tp.R1976C27.4-Stessman2017 T
PARD3B     M20709chr2:
TAGsplicingPaternalsplicing--Stessman2017 T
TRIO     AU2835301chr5:
CTexonicUnknownnonsynonymous SNVNM_007118c.C2479Tp.R827C16.83-Stessman2017 T
PARD3B     M14996chr2:
ATAAexonicPaternalframeshift deletionNM_001302769
--Stessman2017 T
DHX9     109056-200chr1:
CTexonicUnknownnonsynonymous SNVNM_001357c.C1582Tp.R528C19.488.295E-6Stessman2017 T
KMT2E     109580-100chr7:
57.0-Stessman2017 T
SHANK2     108070-100chr11:
CGexonicUnknownunknown26.2-Stessman2017 T
MAP3K1     108990-100chr5:
GAexonicUnknownnonsynonymous SNVNM_005921c.G2558Ap.R853H23.31.0E-4Stessman2017 T
KATNAL2     AU059903chr18:
ACAexonicDe novoframeshift deletionNM_031303c.426delCp.D142fs-1.649E-5Stessman2017 T
ARID1B     AU0901302chr6:
AGsplicingDe novosplicing17.618.238E-6Stessman2017 T
UNC80     110198-100chr2:
CTexonicUnknownnonsynonymous SNVNM_032504
22.14.608E-5Stessman2017 T
DYRK1A     AU048204chr21:
CTexonicDe novostopgainNM_001396
50.0-Stessman2017 T
IQGAP3     B6U2X Complex Event; expand row to view variants  Unknownnonsynonymous SNVNM_178229
32.01.758E-5Stessman2017 T
Stessman2017 T
NCKAP1     B8C8Dchr2:
ATexonicInheritednonsynonymous SNVNM_013436
34.0-Stessman2017 T
WDFY3     A4F4Tchr4:
CTexonicUnknownnonsynonymous SNVNM_014991c.G7099Ap.D2367N26.22.472E-5Stessman2017 T
MYH9     A8Z8Mchr22:
CTexonicInheritednonsynonymous SNVNM_002473c.G4448Ap.R1483Q36.08.307E-6Stessman2017 T
NAV2     C5V2Nchr11:
GAexonicInheritednonsynonymous SNVNM_001111019
31.0-Stessman2017 T
CSTF2T     D2M2Cchr10:
ATTAATGGGexonicInheritedframeshift deletionNM_015235c.1440_1446delp.P480fs--Stessman2017 T
NRXN1     B8Z4Fchr2:
CTsplicingInheritedsplicing22.5-Stessman2017 T
GRIN2B     B9M7Fchr12:
CTexonicUnknownnonsynonymous SNVNM_000834c.G1037Ap.G346E29.1-Stessman2017 T
GLI2     D3G5Achr2:
CTexonicUnknownnonsynonymous SNVNM_005270c.C1433Tp.T478M19.841.652E-5Stessman2017 T
RIMS1     D3P6Hchr6:
CCCCCexonicInheritedframeshift insertionNM_014989c.1406dupCp.P469fs--Stessman2017 T
DNAJC6     D2P3Nchr1:
AGexonicUnknownnonsynonymous SNVNM_001256864
28.3-Stessman2017 T
ANK3     D2P3Nchr10:
CAexonicUnknownnonsynonymous SNVNM_001149
28.7-Stessman2017 T
NAV2     E5B6Ychr11:
TCexonicUnknownnonsynonymous SNVNM_001111019
28.71.0E-4Stessman2017 T
ARID1B     E5J5Mchr6:
GTexonicUnknownnonsynonymous SNVNM_017519
27.88.987E-6Stessman2017 T
SIN3A     D9S5Ychr15:
CGexonicInheritednonsynonymous SNVNM_001145357
35.0-Stessman2017 T
HECTD1     D9Y6Bchr14:
GAexonicUnknownnonsynonymous SNVNM_015382c.C1342Tp.R448W19.18-Stessman2017 T
ADCY9     E9L8Xchr16:
CCCexonicInheritedframeshift deletionNM_001116c.315delGp.L105fs--Stessman2017 T
PLXNB1     E9R8Hchr3:
ACexonicInheritednonsynonymous SNVNM_001130082
13.219.34E-6Stessman2017 T
WNT9A     E7C2Schr1:
CTexonicUnknownnonsynonymous SNVNM_003395c.G932Ap.R311H29.21.694E-5Stessman2017 T
AGAP2     E7G2Uchr12:
CAexonicUnknownnonsynonymous SNVNM_001122772
27.71.648E-5Stessman2017 T
HUWE1     G5A3SchrX:
CTexonicUnknownnonsynonymous SNVNM_031407c.G11888Ap.R3963H17.0-Stessman2017 T
DLG2     G6U8Schr11:
CTexonicInheritednonsynonymous SNVNM_001142702
35.01.713E-5Stessman2017 T
ADCY5     F2D5Vchr3:
CCCCCCCGCCCCCCCCGexonicUnknownframeshift insertionNM_183357c.178dupGp.A60fs-7.932E-5Stessman2017 T
PLXNB1     F8V5Ychr3:
CTexonicUnknownnonsynonymous SNVNM_001130082
25.88.314E-6Stessman2017 T
CUL7     H7E6Mchr6:
CTexonicMaternalnonsynonymous SNVNM_001168370
32.0-Stessman2017 T
MOV10     H7E6Mchr1:
CCAAexonicUnknownnonframeshift substitutionNM_001130079
--Stessman2017 T
DLG4     G9A6Qchr17:
CTexonicInheritednonsynonymous SNVNM_001128827
35.02.042E-5Stessman2017 T
MYT1L     H5B6Cchr2:
CTexonicUnknownnonsynonymous SNVNM_001303052
26.9-Stessman2017 T
DIP2A     J3P5S Complex Event; expand row to view variants  Unknownnonsynonymous SNVNM_001146116
26.48.256E-6Stessman2017 T
Stessman2017 T
CTTNBP2     J7S7Zchr7:
CACCexonicInheritedframeshift deletionNM_033427c.4071_4072delp.L1357fs--Stessman2017 T
RIMS1     H7P2Hchr6:
GAexonicInheritednonsynonymous SNVNM_001168411
32.08.294E-6Stessman2017 T
ANK3     J2Y7Xchr10:
CTexonicInheritednonsynonymous SNVNM_001149
35.08.256E-6Stessman2017 T
DIP2A     M3Z4Qchr21:
CTexonicUnknownnonsynonymous SNVNM_001146115
17.02-Stessman2017 T
UNC80     M5L6Achr2:
GAexonicInheritednonsynonymous SNVNM_032504
33.0-Stessman2017 T
SRCAP       L3C2Schr16:
TCCexonicInheritedframeshift deletionNM_006662c.4029delTp.N1343fs--Stessman2017 T
RELN     M2C4Jchr7:
GAexonicUnknownnonsynonymous SNVNM_005045
34.03.295E-5Stessman2017 T
CUL7     N9F2Nchr6:
CTexonicUnknownnonsynonymous SNVNM_001168370
25.51.648E-5Stessman2017 T
ASH1L     P2S8Zchr1:
CAexonicUnknownnonsynonymous SNVNM_018489c.G4604Tp.R1535L16.658.237E-6Stessman2017 T
AGO4     M9A4Dchr1:
CTexonicUnknownnonsynonymous SNVNM_017629c.C1846Tp.R616W21.1-Stessman2017 T
DOCK8     N6A9Kchr9:
CTexonicUnknownnonsynonymous SNVNM_001193536
16.828.261E-6Stessman2017 T
NEMF     P9B3Schr14:
TCsplicingInheritedsplicing18.62-Stessman2017 T
ARID1B     Q6R5Cchr6:
CTexonicUnknownnonsynonymous SNVNM_017519
22.7-Stessman2017 T
IQGAP3     P3W4Nchr1:
TAexonicUnknownnonsynonymous SNVNM_178229c.A296Tp.H99L26.28.237E-6Stessman2017 T
CTTNBP2     P4N4Wchr7:
CAexonicUnknownnonsynonymous SNVNM_033427c.G4663Tp.D1555Y22.05.268E-5Stessman2017 T
SETBP1     R3L9Pchr18:
CTexonicUnknownnonsynonymous SNVNM_015559c.C3961Tp.R1321C18.292.508E-5Stessman2017 T
DOCK8     R8F8Zchr9:
CTexonicUnknownnonsynonymous SNVNM_001190458
20.21.651E-5Stessman2017 T
ANK3     Q7E4Fchr10:
CTexonicInheritednonsynonymous SNVNM_001204404
35.0-Stessman2017 T
UNC80     R3C2Bchr2:
CTexonicUnknownnonsynonymous SNVNM_032504
26.64.803E-5Stessman2017 T
PROX2     S8M8Zchr14:
GTexonicUnknownnonsynonymous SNVNM_001080408
33.08.281E-6Stessman2017 T
ADNP     211-5367-3chr20:
ATexonicDe novostopgainNM_001282532
45.0-Stessman2017 T
Stessman2017 T
ANK2     S9L7Kchr4:
GAexonicUnknownnonsynonymous SNVNM_001148
25.48.257E-6Stessman2017 T
CHD2     215-13023-0303chr15:
CTexonicDe novostopgainNM_001271c.C4921Tp.Q1641X49.0-Stessman2017 T
Stessman2017 T
MED13L     S5K6Bchr12:
GAexonicUnknownnonsynonymous SNVNM_015335c.C6454Tp.R2152W22.2-Stessman2017 T
DSCAM     S7J3Dchr21:
GAexonicUnknownnonsynonymous SNVNM_001271534
18.498.28E-6Stessman2017 T
RANBP2     T8W2Wchr2:
AGexonicInheritednonsynonymous SNVNM_006267c.A79Gp.M27V9.4151.861E-5Stessman2017 T
ANK3     T8W2Wchr10:
CTexonicUnknownnonsynonymous SNVNM_001149
17.61.656E-5Stessman2017 T
CHD2     T3A5Lchr15:
CTexonicUnknownnonsynonymous SNVNM_001042572
25.12.471E-5Stessman2017 T
CHD8     220-9823-203chr14:
CTexonicUnknownnonsynonymous SNVNM_001170629
18.24-Stessman2017 T
CUL7     T7X5Jchr6:
36.0-Stessman2017 T
CHD8     211-5221-3chr14:
ATsplicingDe novosplicing15.92-Stessman2017 T
Stessman2017 T
GPRIN1     U4V8Tchr5:
CAAACCexonicInheritedframeshift deletionNM_052899c.1973_1976delp.C658fs--Stessman2017 T
CHD7     U5B9Hchr8:
CTexonicUnknownnonsynonymous SNVNM_017780c.C3988Tp.R1330W22.01.0E-4Stessman2017 T
CHD7     U3Q8Vchr8:
CTexonicUnknownnonsynonymous SNVNM_001316690
23.62.533E-5Stessman2017 T
STXBP5     U3V4Pchr6:
GAexonicInheritednonsynonymous SNVNM_139244
36.08.286E-5Stessman2017 T
TCF4     V9Y8Echr18:
20.9-Stessman2017 T
RANBP2     W7R4Wchr2:
CTexonicUnknownnonsynonymous SNVNM_006267c.C8833Tp.R2945W17.96-Stessman2017 T
DIP2A     U5C5Lchr21:
45.01.653E-5Stessman2017 T
ADGRL2     U6G2Jchr1:
TCexonicUnknownnonsynonymous SNVNM_001297705
22.72.473E-5Stessman2017 T
CSMD1     Y6P6Jchr8:
CTexonicUnknownnonsynonymous SNVNM_033225c.G8420Ap.R2807H15.081.803E-5Stessman2017 T
DLGAP1     Y7H4Lchr18:
GAexonicUnknownnonsynonymous SNVNM_001003809
19.298.241E-6Stessman2017 T
ITPR1     X8G5Tchr3:
CTexonicUnknownnonsynonymous SNVNM_001099952
19.23-Stessman2017 T
DIP2A     Y4R4Mchr21:
GAexonicInheritednonsynonymous SNVNM_001146116
34.02.503E-5Stessman2017 T
CHD2     Z2T2Mchr15:
GAexonicInheritednonsynonymous SNVNM_001271c.G5129Ap.R1710Q35.0-Stessman2017 T
UNC80     Z3D2Schr2:
CTexonicUnknownnonsynonymous SNVNM_032504
28.0-Stessman2017 T
IQSEC2     Y9P8UchrX:
CTexonicUnknownnonsynonymous SNVNM_001111125
19.69-Stessman2017 T
CDC45     Y9P9Schr22:
39.0-Stessman2017 T
LZTR1     Z8R7Tchr22:
CCCCCexonicInheritedframeshift insertionNM_006767c.2412dupCp.S804fs--Stessman2017 T
NRXN1     217-14288-4090chr2:
GGGexonicDe novoframeshift deletionNM_138735
--Stessman2017 T
Stessman2017 T
LZTR1     Z9J9Fchr22:
AGCCsplicingInheritedsplicing--Stessman2017 T
GLI2     Z4A7Ychr2:
CCCGGGTAAAAAGGCCexonicInheritedframeshift deletionNM_005270c.82_95delp.P28fs--Stessman2017 T
PAX5     211-5583-3chr9:
CCCCCCCACCCCCCCCAexonicDe novoframeshift insertionNM_001280547
-1.0E-4Stessman2017 T
Stessman2017 T
CUL7     Z7W4Jchr6:
CTsplicingInheritedsplicing19.54-Stessman2017 T
GRIN2B     150281chr12: