or
or
Exact

Results for "CTR9"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CTR9     DEASD_0274_001chr11:
10794110-10794110
CTexonicDe novononsynonymous SNVNM_014633c.C2488Tp.R830W23.5-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
CTR9     SP0002252chr11:
10790026-10790026
CTexonicDe novosynonymous SNVNM_014633c.C2097Tp.S699S-5.0E-4Trost2022 G
CTR9     SJD_59.3chr11:
10801011-10801011
AGUTR3De novo--Trost2022 G
CTR9     1-0382-003chr11:
10775165-10775165
GAintronicDe novo--Trost2022 G
Yuen2017 G
CTR9     2-1487-003chr11:
10794372-10794372
GAintronicDe novo--Trost2022 G
Yuen2017 G
CTR9     1-0067-004chr11:
10787480-10787480
TTAGAGACATTTCCTAGTGCintronicDe novo--Trost2022 G
Yuen2017 G
CTR9     TRE_2419chr11:
10774289-10774289
CGexonicDe novononsynonymous SNVNM_014633c.C116Gp.T39R19.12-Fu2022 E
CTR9     2-1339-003chr11:
10808368-10808368
GAintergenicDe novo--Yuen2017 G
CTR9     SP0103059chr11:
10786236-10786238
CTGCexonicDe novoframeshift deletionNM_014633c.1556_1557delp.L519fs--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
CTR9     2-1759-003chr11:
10789346-10789346
GTintronicDe novo--Trost2022 G
Zhou2022 GE
CTR9     2-1294-003chr11:
10772960-10772960
ATexonicnonsynonymous SNVNM_014633c.A1Tp.M1L22.2-Zhou2022 GE
CTR9     10-1019-003chr11:
10792080-10792080
CTexonicDe novononsynonymous SNVNM_014633c.C2273Tp.A758V29.0-Trost2022 G
Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More