or
or
Exact

Results for "KCNAB2"

Variant Events: 19

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KCNAB2     3-0526-000chr1:
6125609-6125609
CAintronicDe novo--Trost2022 G
KCNAB2     SSC12450chr1:
6154469-6154469
GAexonicnonsynonymous SNVNM_001199863
NM_172130
NM_001199860
NM_001199861
NM_001199862
NM_003636
c.G311A
c.G470A
c.G512A
c.G512A
c.G656A
c.G512A
p.R104H
p.R157H
p.R171H
p.R171H
p.R219H
p.R171H
36.02.414E-5Antaki2022 GE
KCNAB2     3-0832-000chr1:
6116136-6116136
AGintronicDe novo--Trost2022 G
KCNAB2     4-0009-003chr1:
6137292-6137292
CTintronicDe novo--Trost2022 G
KCNAB2     SP0223283chr1:
6133825-6133825
GAexonicDe novononsynonymous SNVNM_001199862
NM_172130
NM_001199860
NM_001199861
NM_003636
c.G295A
c.G154A
c.G196A
c.G196A
c.G196A
p.D99N
p.D52N
p.D66N
p.D66N
p.D66N
27.1-Trost2022 G
KCNAB2     REACH000696chr1:
6089211-6089211
CTintronicDe novo--Trost2022 G
KCNAB2     MSSNG00388-003chr1:
6075563-6075563
CAintronicDe novo--Trost2022 G
KCNAB2     AU3915301chr1:
6150009-6150009
GAintronicDe novo--Trost2022 G
Yuen2017 G
KCNAB2     2-1814-003chr1:
6111962-6111962
GCintronicDe novo--Trost2022 G
KCNAB2     2-1526-004chr1:
6103325-6103360
GCCAGCTCAAAAGGGCTGCCCACAGGTACAGACCATGintronicDe novo--Trost2022 G
KCNAB2     1-0493-003chr1:
6132912-6132912
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
KCNAB2     2-1441-003chr1:
6061203-6061203
CGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
KCNAB2     SP0184122chr1:
6160032-6160032
CGUTR3De novo5.803-Trost2022 G
KCNAB2     AU2089301chr1:
6159708-6159708
AGUTR3De novo--Trost2022 G
Yuen2017 G
KCNAB2     AU3692302chr1:
6117606-6117606
AGintronicDe novo--Trost2022 G
Yuen2017 G
KCNAB2     3-0407-000chr1:
6065018-6065018
GTintronicDe novo--Trost2022 G
KCNAB2     REACH000224chr1:
6157462-6157462
GAintronicDe novo-5.214E-5Trost2022 G
Zhou2022 GE
KCNAB2     SP0079786chr1:
6145873-6145873
GAintronicDe novo--Fu2022 E
KCNAB2     14507.p1chr1:
6154469-6154469
GAexonicnonsynonymous SNVNM_001199863
NM_172130
NM_001199860
NM_001199861
NM_001199862
NM_003636
c.G311A
c.G470A
c.G512A
c.G512A
c.G656A
c.G512A
p.R104H
p.R157H
p.R171H
p.R171H
p.R219H
p.R171H
36.02.414E-5Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More