or
or
Exact

Results for "PICALM"

Variant Events: 31

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PICALM     2-1085-003chr11:
85874478-85874478
GAintergenicDe novo--Yuen2017 G
PICALM     AU2863303chr11:
85883464-85883464
CAintergenicDe novo--Yuen2017 G
PICALM     1-0248-003chr11:
85724529-85724544
AACACACACACACACAAACACACACACACAintronicDe novo--Yuen2017 G
PICALM     3-0198-000chr11:
85675616-85675617
CTAAintronicDe novo--Trost2022 G
PICALM     3-0519-000chr11:
85680371-85680371
GAintronicDe novo--Trost2022 G
PICALM     2-1292-004chr11:
85687648-85687648
AACintronicDe novo--Trost2022 G
Yuen2017 G
PICALM     REACH000467chr11:
85675175-85675175
CTintronicDe novo--Trost2022 G
PICALM     SP0137641chr11:
85711749-85711759
GAGGTGGATACGexonicDe novoframeshift deletionNM_001008660
NM_001206946
NM_001206947
NM_007166
c.1081_1090del
c.1081_1090del
c.928_937del
c.1081_1090del
p.V361fs
p.V361fs
p.V310fs
p.V361fs
--Antaki2022 GE
Fu2022 E
Zhou2022 GE
PICALM     1-0469-003chr11:
85711080-85711080
GAintronicDe novo--Trost2022 G
Yuen2017 G
PICALM     5-5015-003chr11:
85763437-85763437
CTintronicDe novo--Trost2022 G
PICALM     3-0515-000chr11:
85739836-85739836
CCTintronicDe novo--Trost2022 G
PICALM     2-1359-005chr11:
85743434-85743434
TCintronicDe novo--Trost2022 G
PICALM     5-0101-003chr11:
85730712-85730712
TAintronicDe novo--Trost2022 G
PICALM     2-0307-003chr11:
85799918-85799918
TCintergenicDe novo--Yuen2017 G
PICALM     AU2218301chr11:
85734093-85734093
ATintronicDe novo--Trost2022 G
PICALM     1-0133-003chr11:
85696056-85696056
CAintronicDe novo--Trost2022 G
PICALM     1-0054-004chr11:
85707644-85707650
TTTTATCTintronicDe novo--Yuen2017 G
PICALM     3-0072-000chr11:
85706367-85706367
TCintronicDe novo--Trost2022 G
PICALM     2-1341-004chr11:
85699196-85699196
TAintronicDe novo--Trost2022 G
Yuen2017 G
PICALM     1-0403-004chr11:
85941116-85941116
GAintergenicDe novo--Yuen2017 G
PICALM     2-1591-003chr11:
85761260-85761260
ACintronicDe novo--Trost2022 G
Yuen2017 G
PICALM     1-0994-003chr11:
85795326-85795326
CGintergenicDe novo--Yuen2017 G
PICALM     1-0048-003chr11:
85758415-85758415
AGintronicDe novo--Trost2022 G
Yuen2017 G
PICALM     7-0251-003chr11:
85759384-85759384
TCintronicDe novo--Trost2022 G
Yuen2017 G
PICALM     5-0054-003chr11:
85923457-85923457
GAintergenicDe novo--Yuen2017 G
PICALM     5-0054-003chr11:
85926307-85926307
GCintergenicDe novo--Yuen2017 G
PICALM     5-0054-003chr11:
85951959-85951959
GCintergenicDe novo--Yuen2017 G
PICALM     2-1207-003chr11:
85671018-85671018
CTintronicDe novo--Yuen2017 G
PICALM     5-0054-003chr11:
85922332-85922332
TCintergenicDe novo--Yuen2017 G
PICALM     1-0054-003chr11:
85707644-85707650
TTTTATCTintronicDe novo--Yuen2017 G
PICALM     AU2427303chr11:
85872271-85872321
CAATGTCTTGTTTAATGTTCTATTAAATGTCTTGTTTAATGTTCTATTAAACAATGTCTTGTTTAATGTTCTATTAAAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More