or
or
Exact

Results for "SIPA1L2"

Variant Events: 61

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SIPA1L2     2-0003-004chr1:
232305308-232305308
TCintergenicDe novo--Yuen2017 G
SIPA1L2     AU071804chr1:
232497338-232497338
AGintergenicDe novo--Yuen2017 G
SIPA1L2     2-1066-004chr1:
232193010-232193010
TCintergenicDe novo--Yuen2017 G
SIPA1L2     2-1776-003chr1:
232651183-232651183
CTUTR5De novo--Trost2022 G
SIPA1L2     2-1228-003chr1:
232858195-232858195
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
SIPA1L2     SP0086561chr1:
232650966-232650966
GAexonicDe novosynonymous SNVNM_020808c.C120Tp.A40A-8.294E-6Fu2022 E
Trost2022 G
Zhou2022 GE
SIPA1L2     1-0695-004chr1:
232642184-232642184
TCintronicDe novo--Trost2022 G
SIPA1L2     AU4359301chr1:
232325647-232325647
CTintergenicDe novo--Yuen2017 G
SIPA1L2     2-0256-004chr1:
232231599-232231599
CTintergenicDe novo--Yuen2017 G
SIPA1L2     7-0197-003chr1:
232293296-232293296
GAintergenicDe novo--Yuen2017 G
SIPA1L2     A28chr1:
232471763-232471763
CTintergenicDe novo--Wu2018 G
SIPA1L2     2-1258-004chr1:
232702512-232702512
TAintergenicDe novo--Yuen2017 G
SIPA1L2     1-0112-004chr1:
232586976-232586976
CTintronicDe novo--Trost2022 G
Yuen2017 G
SIPA1L2     AU2100302chr1:
232534627-232534627
GAUTR3De novo--Trost2022 G
Yuen2017 G
SIPA1L2     7-0035-003chr1:
232598128-232598128
AGintronicDe novo--Yuen2017 G
SIPA1L2     2-1167-003chr1:
232251947-232251947
GTintergenicDe novo--Yuen2017 G
SIPA1L2     1-0354-006chr1:
232837078-232837084
GTGCATCGintergenicDe novo--Yuen2017 G
SIPA1L2     1-0973-003chr1:
232697003-232697003
GAintergenicDe novo--Yuen2017 G
SIPA1L2     AU3984302chr1:
232729351-232729351
TAintergenicDe novo--Yuen2017 G
SIPA1L2     2-1183-003chr1:
232379539-232379539
CTintergenicDe novo--Yuen2017 G
SIPA1L2     SP0011595chr1:
232568177-232568177
TCexonicDe novononsynonymous SNVNM_020808c.A4072Gp.K1358E18.79-Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
SIPA1L2     1-0186-005chr1:
232706135-232706135
CTintergenicDe novo--Yuen2017 G
SIPA1L2     SP0083577chr1:
232649874-232649879
GTCGTTGexonicframeshift deletionNM_020808c.1207_1211delp.N403fs--Antaki2022 GE
SIPA1L2     1-0912-003chr1:
232183024-232183024
ATintergenicDe novo--Yuen2017 G
SIPA1L2     AU3371305chr1:
232216007-232216007
GAintergenicDe novo--Yuen2017 G
SIPA1L2     AU4212303chr1:
232430182-232430182
TCintergenicDe novo--Yuen2017 G
SIPA1L2     SP0083577chr1:
232649920-232649924
GAGTTGexonicframeshift deletionNM_020808c.1162_1165delp.N388fs--Antaki2022 GE
SIPA1L2     2-0295-004chr1:
232759144-232759144
GAintergenicDe novo--Yuen2017 G
SIPA1L2     SP0083577 Complex Event; expand row to view variants  frameshift substitution, frameshift deletionNM_020808
NM_020808
c.1174_1204del
c.1162_1204CCAAAGAG
p.N392fs
N/A
--Antaki2022 GE
Zhou2022 GE
SIPA1L2     AU050910chr1:
232555153-232555153
CTintronicDe novo--Yuen2017 G
SIPA1L2     2-1154-003chr1:
232510592-232510592
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
SIPA1L2     1-0153-005chr1:
232325363-232325363
GAintergenicDe novo--Yuen2017 G
SIPA1L2     AU2162302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
SIPA1L2     2-0135-004chr1:
232180030-232180030
GAintergenicDe novo--Yuen2017 G
SIPA1L2     12228.p1chr1:
232551231-232551233
AGTGGGintronicDe novo--Krumm2015 E
SIPA1L2     1-0296-004chr1:
232388700-232388700
CGintergenicDe novo--Yuen2017 G
SIPA1L2     2-1169-003chr1:
232552854-232552854
TCintronicDe novo--Trost2022 G
Yuen2017 G
SIPA1L2     AU072005chr1:
232537364-232537364
ACintronicDe novo--Trost2022 G
Yuen2017 G
SIPA1L2     AU4219302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
SIPA1L2     AU3790302chr1:
232739849-232739849
TCintergenicDe novo--Yuen2017 G
SIPA1L2     1-0272-003chr1:
232498016-232498016
CTintergenicDe novo--Yuen2017 G
SIPA1L2     AU028305chr1:
232395733-232395733
CTintergenicDe novo--Yuen2017 G
SIPA1L2     AU028305chr1:
232656645-232656645
CAintergenicDe novo--Yuen2017 G
SIPA1L2     2-1521-003chr1:
232337217-232337217
CTintergenicDe novo--Yuen2017 G
SIPA1L2     AU003403chr1:
232539419-232539419
TGintronicDe novo--Yuen2017 G
SIPA1L2     AU3874301chr1:
232794091-232794091
TCintergenicDe novo--Yuen2017 G
SIPA1L2     2-1729-003chr1:
232432682-232432682
CTintergenicDe novo--Yuen2017 G
SIPA1L2     1-0914-003chr1:
232755522-232755522
TCintergenicDe novo--Yuen2017 G
SIPA1L2     1-0611-005chr1:
232569830-232569830
CTintronicDe novo--Trost2022 G
SIPA1L2     REACH000675chr1:
232551196-232551196
ACintronicDe novo--Trost2022 G
SIPA1L2     80001105178chr1:
232577560-232577560
GAexonicDe novosynonymous SNVNM_020808c.C3492Tp.D1164D-4.351E-5Fu2022 E
SIPA1L2     SP0031609chr1:
232575164-232575164
GAexonicDe novononsynonymous SNVNM_020808c.C3721Tp.H1241Y22.0-Fu2022 E
Trost2022 G
Zhou2022 GE
SIPA1L2     1-0264-006chr1:
232633715-232633715
AGintronicDe novo--Trost2022 G
SIPA1L2     F9313-1chr1:
232596754-232596754
CTexonicDe novononsynonymous SNVNM_020808c.G2974Ap.V992M32.08.306E-5Fu2022 E
SIPA1L2     SP0057703chr1:
232534886-232534886
TCexonicDe novononsynonymous SNVNM_020808c.A5156Gp.D1719G27.9-Fu2022 E
Trost2022 G
Zhou2022 GE
SIPA1L2     4-0054-003chr1:
232587775-232587778
ATCAGCCGGGCGCGGTGGCTCintronicDe novo--Trost2022 G
SIPA1L2     2-0223-004chr1:
232733150-232733150
GAintergenicDe novo--Yuen2017 G
SIPA1L2     MSSNG00029-003chr1:
232649662-232649662
TCexonicDe novononsynonymous SNVNM_020808c.A1424Gp.Y475C18.78-Trost2022 G
Zhou2022 GE
SIPA1L2     1-0627-007chr1:
232306831-232306831
TCintergenicDe novo--Yuen2017 G
SIPA1L2     3-0345-000chr1:
232549438-232549438
TAintronicDe novo--Trost2022 G
SIPA1L2     MSSNG00216-003chr1:
232538392-232538392
TGintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More