or
or
Exact

Results for "PACS1"

Variant Events: 40

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PACS1     14359.p1chr11:
66002793-66002793
GAexonicnonsynonymous SNVNM_018026c.G2126Ap.R709Q36.08.257E-6Zhou2022 GE
PACS1     ASC_9712chr11:
65978677-65978677
CTexonicDe novononsynonymous SNVNM_018026c.C607Tp.R203W21.18.237E-6Fu2022 E
PACS1     SP0226234chr11:
65978677-65978677
CTexonicnonsynonymous SNVNM_018026c.C607Tp.R203W21.18.237E-6Zhou2022 GE
PACS1     AU031404chr11:
65998407-65998407
CTexonicDe novononsynonymous SNVNM_018026c.C1622Tp.T541M10.651.71E-5Trost2022 G
Yuen2017 G
Zhou2022 GE
PACS1     SP0052828chr11:
65978677-65978677
CTexonicDe novononsynonymous SNVNM_018026c.C607Tp.R203W21.18.237E-6Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
PACS1     AU2695301chr11:
65998330-65998330
GAexonicsynonymous SNVNM_018026c.G1545Ap.E515E--Zhou2022 GE
PACS1     1-0459-003chr11:
66002964-66002964
CAintronicDe novo--Yuen2017 G
PACS1     SP0053143chr11:
65838058-65838058
CCGCAexonicnonframeshift insertionNM_018026c.101_102insGCAp.P34delinsPQ-4.0E-4Zhou2022 GE
PACS1     PN400504chr11:
65988145-65988145
AGexonicUnknownnonsynonymous SNVNM_018026c.A1082Gp.E361G25.1-Leblond2019 E
PACS1     1678001chr11:
66006665-66006665
ACexonicDe novosynonymous SNVNM_018026c.A2346Cp.P782P--Fu2022 E
PACS1     F517-2K349-9F181chr11:
65978677-65978677
CTexonicDe novononsynonymous SNVNM_018026c.C607Tp.R203W21.18.237E-6Fu2022 E
PACS1     2-1089-003chr11:
65843709-65843709
CTintronicDe novo--Trost2022 G
Yuen2017 G
PACS1     AU012804chr11:
65859667-65859667
TCintronicDe novo--Yuen2017 G
PACS1     5-0015-003chr11:
65935210-65935210
AGintronicDe novo--Trost2022 G
Yuen2017 G
PACS1     PN400393chr11:
65988145-65988145
AGexonicUnknownnonsynonymous SNVNM_018026c.A1082Gp.E361G25.1-Leblond2019 E
PACS1     5-0003-003chr11:
66019813-66019813
GAintergenicDe novo--Yuen2017 G
PACS1     AU046708chr11:
65915496-65915496
CAintronicDe novo--Trost2022 G
Yuen2017 G
PACS1     2-1232-003chr11:
65955480-65955480
AGintronicDe novo--Trost2022 G
PACS1     1-0490-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
Yuen2017 G
Yuen2017 G
PACS1     AU030703chr11:
65970140-65970140
GAintronicDe novo--Trost2022 G
Yuen2017 G
PACS1     9-0027-003chr11:
65976861-65976880
TTCCTGGGAAAAAAAAGGAATintronicDe novo--Trost2022 G
PACS1     2-1456-004chr11:
65929126-65929130
TAAAATintronicDe novo--Trost2022 G
PACS1     5-5069-003chr11:
65945755-65945755
TCintronicDe novo--Trost2022 G
PACS1     7-0419-003chr11:
65903589-65903589
GAintronicDe novo--Trost2022 G
PACS1     AU1448301chr11:
65917941-65917941
TAintronicDe novo--Trost2022 G
PACS1     2-0223-003chr11:
65912844-65912844
GAintronicDe novo--Trost2022 G
Yuen2017 G
PACS1     4-0062-003chr11:
65852711-65852712
AGCTintronicDe novo--Trost2022 G
PACS1     AU072004chr11:
65926011-65926011
ACintronicDe novo--Trost2022 G
Yuen2017 G
PACS1     2-1430-005Achr11:
65995348-65995348
GAintronicDe novo--Trost2022 G
PACS1     1-0196-005chr11:
65931773-65931773
TCintronicDe novo--Trost2022 G
Yuen2017 G
PACS1     3-0099-001Achr11:
65988103-65988103
TCexonicDe novononsynonymous SNVNM_018026c.T1040Cp.V347A22.9-Trost2022 G
PACS1     1-0104-003chr11:
66019883-66019883
AAGTAGCTGGGATTACAGGCATGCintergenicDe novo--Yuen2017 G
PACS1     08C75919chr11:
65998330-65998330
GAexonicDe novosynonymous SNVNM_018026c.G1545Ap.E515E--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
PACS1     2-1409-003chr11:
65988455-65988455
ACintronicDe novo--Trost2022 G
PACS1     7-0235-003chr11:
65976861-65976880
TTCCTGGGAAAAAAAAGGAATintronicDe novo--Trost2022 G
PACS1     2-0320-003chr11:
65864866-65864866
GTintronicDe novo--Trost2022 G
Yuen2017 G
PACS1     SSC11456chr11:
66002793-66002793
GAexonicDe novononsynonymous SNVNM_018026c.G2126Ap.R709Q36.08.257E-6Antaki2022 GE
Fu2022 E
Lim2017 E
PACS1     2-1366-004chr11:
65984310-65984319
AGCATATTCACACCGCGCCCintronicDe novo--Trost2022 G
PACS1     SP0139913chr11:
66006569-66006569
TGintronicDe novo-8.239E-6Fu2022 E
Trost2022 G
PACS1     AU2569301chr11:
65838091-65838093
CGACexonicMaternalframeshift deletionNM_018026c.135_136delp.P45fs--Cirnigliaro2023 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More