or
or
Exact

Results for "HEATR1"

Variant Events: 27

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
HEATR1     1-0433-003chr1:
236809930-236809930
ATintergenicDe novo--Yuen2017 G
HEATR1     2-1444-003chr1:
236759212-236759213
TCTexonicDe novoframeshift deletionNM_018072c.876delGp.K292fs--Trost2022 G
Yuen2016 G
Yuen2017 G
Zhou2022 GE
HEATR1     3-0728-000chr1:
236721174-236721174
TCintronicDe novo--Trost2022 G
HEATR1     7-0179-003chr1:
236733749-236733766
ATGGTGGTGGTGGTGGTGATGGTGGTGGTGGTGintronicDe novo--Yuen2017 G
HEATR1     7-0363-003chr1:
236717645-236717645
TCintronicDe novo--Trost2022 G
HEATR1     3-0708-000chr1:
236722339-236722339
AGexonicDe novosynonymous SNVNM_018072c.T4867Cp.L1623L--Trost2022 G
Zhou2022 GE
HEATR1     PN400514chr1:
236718894-236718894
AGexonicUnknownnonsynonymous SNVNM_018072c.T5711Cp.V1904A21.5-Leblond2019 E
HEATR1     1-0826-003chr1:
236828222-236828222
CAintergenicDe novo--Yuen2017 G
HEATR1     PN400367chr1:
236718894-236718894
AGexonicUnknownnonsynonymous SNVNM_018072c.T5711Cp.V1904A21.5-Leblond2019 E
HEATR1     SP0028004chr1:
236749748-236749748
CTexonicDe novononsynonymous SNVNM_018072c.G1720Ap.E574K0.0151.666E-5Fu2022 E
Trost2022 G
Zhou2022 GE
HEATR1     PN400283chr1:
236718894-236718894
AGexonicUnknownnonsynonymous SNVNM_018072c.T5711Cp.V1904A21.5-Leblond2019 E
HEATR1     PN400410chr1:
236718894-236718894
AGexonicUnknownnonsynonymous SNVNM_018072c.T5711Cp.V1904A21.5-Leblond2019 E
HEATR1     7-0332-003chr1:
236751836-236751836
TCintronicDe novo--Trost2022 G
HEATR1     7-0121-003chr1:
236737073-236737073
ACintronicDe novo--Trost2022 G
HEATR1     AU3051303chr1:
236768757-236768757
GAupstreamDe novo--Trost2022 G
Yuen2017 G
HEATR1     SP0009068chr1:
236719226-236719226
GAexonicDe novononsynonymous SNVNM_018072c.C5528Tp.P1843L15.995.765E-5Fu2022 E
Trost2022 G
Zhou2022 GE
HEATR1     1-0991-003chr1:
236844801-236844801
GAintergenicDe novo--Yuen2017 G
HEATR1     PN400415chr1:
236718894-236718894
AGexonicUnknownnonsynonymous SNVNM_018072c.T5711Cp.V1904A21.5-Leblond2019 E
HEATR1     PN400282chr1:
236718894-236718894
AGexonicUnknownnonsynonymous SNVNM_018072c.T5711Cp.V1904A21.5-Leblond2019 E
HEATR1     F9288-1chr1:
236740215-236740215
GAexonicDe novosynonymous SNVNM_018072c.C2790Tp.P930P-8.293E-6Satterstrom2020 E
Trost2022 G
Zhou2022 GE
HEATR1     01C07361chr1:
236738100-236738100
GAexonicDe novononsynonymous SNVNM_018072c.C3188Tp.T1063I0.057-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
HEATR1     PN400515chr1:
236718894-236718894
AGexonicUnknownnonsynonymous SNVNM_018072c.T5711Cp.V1904A21.5-Leblond2019 E
HEATR1     1-0226-005chr1:
236743450-236743450
CTintronicDe novo--Trost2022 G
Yuen2017 G
HEATR1     PN400332chr1:
236718894-236718894
AGexonicUnknownnonsynonymous SNVNM_018072c.T5711Cp.V1904A21.5-Leblond2019 E
HEATR1     PN400476chr1:
236718894-236718894
AGexonicUnknownnonsynonymous SNVNM_018072c.T5711Cp.V1904A21.5-Leblond2019 E
HEATR1     2-1140-003chr1:
236726794-236726794
GAintronicDe novo--Yuen2017 G
HEATR1     SP0035186chr1:
236718593-236718597
CACCTCexonicDe novoframeshift deletionNM_018072c.5922_5923delp.T1974fs--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More