or
or
Exact

Results for "PAK1"

Variant Events: 24

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PAK1     AU3918301chr11:
77247920-77247920
AGintergenicDe novo--Yuen2017 G
PAK1     1-0652-003chr11:
77157878-77157878
TCintronicDe novo--Trost2022 G
Yuen2017 G
PAK1     AU4006302chr11:
77260735-77260735
TGintergenicDe novo--Yuen2017 G
PAK1     1-0208-003chr11:
77109161-77109161
CTintronicDe novo--Trost2022 G
Yuen2017 G
PAK1     AU185Achr11:
77048478-77048478
TGintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
PAK1     2-0057-004chr11:
77073086-77073086
TTTAAGATTACTAATGTTACTAAintronicDe novo--Yuen2017 G
PAK1     AU031204chr11:
77214162-77214162
ATintergenicDe novo--Yuen2017 G
PAK1     SP0058411chr11:
77090387-77090387
GAexonicDe novononsynonymous SNVNM_001128620
NM_002576
c.C338T
c.C338T
p.T113I
p.T113I
26.8-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
PAK1     MSSNG00257-005chr11:
77126786-77126786
CTintronicDe novo--Trost2022 G
PAK1     3-0647-000chr11:
77129735-77129735
TCintronicDe novo--Trost2022 G
PAK1     1-1135-003chr11:
77057710-77057710
GAintronicDe novo--Trost2022 G
PAK1     5-5130-004chr11:
77099460-77099460
GAintronicDe novo--Trost2022 G
PAK1     AU3911301chr11:
77043113-77043113
CTintronicDe novo--Trost2022 G
Yuen2017 G
PAK1     4-0049-003chr11:
77044434-77044434
GCintronicDe novo--Trost2022 G
PAK1     1033chr11:
77057592-77057592
AGintronicDe novo--Trost2022 G
PAK1     MSSNG00030-004chr11:
77037686-77037686
GAintronicDe novo--Trost2022 G
PAK1     MSSNG00159-003chr11:
77041173-77041175
TAATintronicDe novo--Trost2022 G
PAK1     1-0585-003chr11:
77115391-77115391
CGintronicDe novo--Trost2022 G
Yuen2017 G
PAK1     1-0218-004chr11:
77078733-77078733
ACintronicDe novo--Trost2022 G
Yuen2017 G
PAK1     AU4032305chr11:
77078367-77078367
ACintronicDe novo--Trost2022 G
Yuen2017 G
PAK1     MSSNG00242-003chr11:
77135366-77135366
CTintronicDe novo--Trost2022 G
PAK1     MT_81.3chr11:
77160647-77160647
ACintronicDe novo--Trost2022 G
PAK1     5-5024-003chr11:
77130583-77130583
CTintronicDe novo--Trost2022 G
PAK1     7-0024-003chr11:
77130644-77130645
AGTCintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More