or
or
Exact

Results for "SERGEF"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SERGEF     SP0146418chr11:
18029481-18029481
ACintronicDe novo--Fu2022 E
SERGEF     1-0467-005chr11:
17921960-17921960
TCintronicDe novo--Trost2022 G
Yuen2017 G
SERGEF     mAGRE3090chr11:
18017409-18017409
GAexonicMaternalstopgainNM_012139c.C556Tp.R186X37.03.0E-4Cirnigliaro2023 G
SERGEF     3-0438-000chr11:
17814202-17814202
GAintronicDe novo--Trost2022 G
Yuen2016 G
SERGEF     AU4237304chr11:
18017409-18017409
GAexonicMaternalstopgainNM_012139c.C556Tp.R186X37.03.0E-4Cirnigliaro2023 G
SERGEF     AU4237302chr11:
18017409-18017409
GAexonicMaternalstopgainNM_012139c.C556Tp.R186X37.03.0E-4Cirnigliaro2023 G
SERGEF     1-0593-003chr11:
18031266-18031284
CTATTATTATTATTATTATCTATTATTATTATTATintronicDe novo--Yuen2017 G
SERGEF     2-1456-003chr11:
18022502-18022502
TCintronicDe novo--Trost2022 G
Yuen2017 G
SERGEF     MSSNG00133-003chr11:
17904765-17904765
GCintronicDe novo--Trost2022 G
SERGEF     1-1189-003chr11:
17924664-17924664
CTintronicDe novo--Trost2022 G
SERGEF     3-0163-000chr11:
17859589-17859589
CTintronicDe novo--Trost2022 G
SERGEF     1-1182-003chr11:
17860036-17860036
AGintronicDe novo--Trost2022 G
SERGEF     MSSNG00349-003chr11:
17823795-17823795
CGintronicDe novo--Trost2022 G
SERGEF     AU4007302chr11:
17979547-17979547
TCintronicDe novo--Trost2022 G
Yuen2017 G
SERGEF     SSC00428chr11:
17876348-17876348
GTintronic--Antaki2022 GE
SERGEF     5-0020-003chr11:
17947131-17947131
TTGintronicDe novo--Trost2022 G
SERGEF     5-0020-003chr11:
17947133-17947133
CCAAintronicDe novo--Trost2022 G
SERGEF     AU055603chr11:
17944423-17944423
TGintronicDe novo--Trost2022 G
SERGEF     MSSNG00441-003chr11:
17944844-17944844
GAintronicDe novo--Trost2022 G
SERGEF     AU3636301chr11:
17828478-17828478
CTintronicDe novo--Trost2022 G
Yuen2017 G
SERGEF     1-0599-005chr11:
17942496-17942496
AGintronicDe novo--Trost2022 G
SERGEF     MSSNG00346-004chr11:
17943777-17943777
CTintronicDe novo--Trost2022 G
SERGEF     5-5014-003chr11:
17929915-17929915
TCintronicDe novo--Trost2022 G
SERGEF     MSSNG00336-003chr11:
17932588-17932588
ACintronicDe novo--Trost2022 G
SERGEF     AU2427303chr11:
17914262-17914262
AGintronicDe novo--Trost2022 G
Yuen2017 G
SERGEF     SP0023289chr11:
18034335-18034335
CCAACACCAAintronicDe novo--Fu2022 E
SERGEF     SP0126138chr11:
18029482-18029482
ACintronicDe novo--Trost2022 G
SERGEF     MT_56.3chr11:
17951112-17951132
TGCCATTCATTCATTGTTTTATintronicDe novo--Trost2022 G
SERGEF     2-1757-003chr11:
17990576-17990576
GAintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More