or
or
Exact

Results for "ADAMTS12"

Variant Events: 28

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADAMTS12     1-0820-003chr5:
33836677-33836677
GAintronicDe novo--Yuen2017 G
ADAMTS12     5-0015-004chr5:
33745852-33745852
TTAintronicDe novo--Yuen2017 G
ADAMTS12     2-1357-004chr5:
33703246-33703246
CTintronicDe novo--Yuen2017 G
ADAMTS12     AU2029302chr5:
33927947-33927947
GAintergenicDe novo--Yuen2017 G
ADAMTS12     2-1480-003chr5:
33852007-33852022
GCACACACACACACACGCACACACACACACintronicDe novo--Yuen2017 G
ADAMTS12     5-0050-004chr5:
33541761-33541761
GGCCintronicDe novo--Yuen2017 G
ADAMTS12     2-0318-003chr5:
33765381-33765381
AGintronicDe novo--Yuen2017 G
ADAMTS12     2-1268-003chr5:
33687408-33687408
TGintronicDe novo--Yuen2016 G
Yuen2017 G
ADAMTS12     AU3862305chr5:
33784642-33784642
TCintronicDe novo--Yuen2017 G
ADAMTS12     A2chr5:
33736957-33736957
GTintronicDe novo--Wu2018 G
ADAMTS12     5-0103-003chr5:
33865681-33865681
TCintronicDe novo--Yuen2017 G
ADAMTS12     AU1355301chr5:
33828210-33828210
CTintronicDe novo--Yuen2017 G
ADAMTS12     AU063004chr5:
33933894-33933894
CTintergenicDe novo--Yuen2017 G
ADAMTS12     AU4344301chr5:
33849515-33849515
CTintronicDe novo--Yuen2017 G
ADAMTS12     iHART1212chr5:
33549310-33549310
AGsplicingMaternalsplicing14.125.961E-5Ruzzo2019 G
ADAMTS12     13324.p1chr5:
33889286-33889286
GAintronicDe novo--Turner2016 G
ADAMTS12     iHART1207chr5:
33549310-33549310
AGsplicingMaternalsplicing14.125.961E-5Ruzzo2019 G
ADAMTS12     iHART2202chr5:
33881583-33881585
GCTGexonicPaternalframeshift deletionNM_030955c.128_129delp.E43fs-2.0E-4Ruzzo2019 G
ADAMTS12     iHART2200chr5:
33881583-33881585
GCTGexonicPaternalframeshift deletionNM_030955c.128_129delp.E43fs-2.0E-4Ruzzo2019 G
ADAMTS12     1-0834-003chr5:
33879265-33879265
GAintronicDe novo--Yuen2017 G
ADAMTS12     7-0248-003chr5:
33726421-33726421
AGintronicDe novo--Yuen2017 G
ADAMTS12     1-0325-003chr5:
33810853-33810853
CGintronicDe novo--Yuen2017 G
ADAMTS12     2-1341-003chr5:
33880949-33880949
CTintronicDe novo--Yuen2017 G
ADAMTS12     2-1518-003chr5:
33540612-33540612
ACintronicDe novo--Yuen2017 G
ADAMTS12     1-0595-005chr5:
33740650-33740650
GAintronicDe novo--Yuen2017 G
ADAMTS12     2-1265-003chr5:
33693201-33693201
CTintronicDe novo--Yuen2016 G
Yuen2017 G
ADAMTS12     14547.p1chr5:
33921599-33921602
TACATintergenicDe novo--Werling2018 G
ADAMTS12     AU2029303chr5:
33927947-33927947
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More