or
or
Exact

Results for "YY1P2"

Variant Events: 66

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
YY1P2   2-1322-004chr2:
139853748-139853748
AGintergenicDe novo--Yuen2017 G
YY1P2   1-0804-003chr2:
140769799-140769799
TCintergenicDe novo--Yuen2017 G
YY1P2   AU1542303chr2:
140706787-140706787
GAintergenicDe novo--Yuen2017 G
YY1P2   AU2139305chr2:
140316415-140316415
CAintergenicDe novo--Yuen2017 G
YY1P2   13732.p1chr2:
140912252-140912252
GAintergenicDe novo--Werling2018 G
YY1P2   AU3760302chr2:
140641814-140641814
AGintergenicDe novo--Yuen2017 G
YY1P2   5-0064-003chr2:
140393572-140393572
AGintergenicDe novo--Yuen2017 G
YY1P2   2-1362-004chr2:
140082482-140082482
GTintergenicDe novo--Yuen2017 G
YY1P2   2-1456-004chr2:
140235254-140235254
CTintergenicDe novo--Yuen2017 G
YY1P2   1-0467-003chr2:
140433526-140433526
TCintergenicDe novo--Yuen2017 G
YY1P2   AU4286302chr2:
139850324-139850324
GAintergenicDe novo--Yuen2017 G
YY1P2   2-0256-004chr2:
140480791-140480792
ACAintergenicDe novo--Yuen2017 G
YY1P2   1-0990-003chr2:
140674777-140674777
GAintergenicDe novo--Yuen2017 G
YY1P2   1-0433-004chr2:
140851320-140851320
GAintergenicDe novo--Yuen2017 G
YY1P2   1-0571-003chr2:
140165533-140165533
GAintergenicDe novo--Yuen2017 G
YY1P2   1-0675-003chr2:
139681292-139681292
AGintergenicDe novo--Yuen2017 G
YY1P2   14370.p1chr2:
140851382-140851382
GAintergenicDe novo--Turner2016 G
YY1P2   2-0503-004chr2:
139874260-139874270
AAACTGATCCTAintergenicDe novo--Yuen2017 G
YY1P2   AU074503chr2:
139754242-139754242
TCintergenicDe novo--Yuen2017 G
YY1P2   1-0162-004chr2:
140152676-140152676
CTintergenicDe novo--Yuen2017 G
YY1P2   1-0206-005chr2:
139701251-139701251
TCintergenicDe novo--Yuen2017 G
YY1P2   2-1352-003chr2:
139932186-139932186
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
YY1P2   2-0303-004chr2:
140086424-140086424
GAintergenicDe novo--Yuen2017 G
YY1P2   1-0585-003chr2:
140555255-140555255
GTintergenicDe novo--Yuen2017 G
YY1P2   AU2140306chr2:
140776474-140776476
GCCGCintergenicDe novo--Yuen2017 G
YY1P2   2-1422-003chr2:
140181409-140181410
GAGintergenicDe novo--Yuen2016 G
YY1P2   1-0547-003chr2:
140091608-140091608
CAintergenicDe novo--Yuen2017 G
YY1P2   2-1196-003chr2:
139739340-139739340
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
YY1P2   2-1411-003chr2:
140391929-140391933
CACTACintergenicDe novo--Yuen2016 G
YY1P2   2-0142-003chr2:
140598475-140598475
GAintergenicDe novo--Yuen2017 G
YY1P2   1-0052-003chr2:
140180880-140180880
AATintergenicDe novo--Yuen2017 G
YY1P2   1-0099-003chr2:
140615605-140615605
ATintergenicDe novo--Yuen2017 G
YY1P2   1-0994-003chr2:
140130832-140130832
GAintergenicDe novo--Yuen2017 G
YY1P2   AU4356302chr2:
140004365-140004365
CTintergenicDe novo--Yuen2017 G
YY1P2   AU3900302chr2:
140399309-140399309
ATintergenicDe novo--Yuen2017 G
YY1P2   2-0307-004chr2:
140435959-140435959
TCintergenicDe novo--Yuen2017 G
YY1P2   1-0627-003chr2:
139693718-139693718
CTintergenicDe novo--Yuen2017 G
YY1P2   1-0344-003chr2:
139695402-139695402
GAintergenicDe novo--Yuen2017 G
YY1P2   5-0077-003chr2:
140143348-140143348
AGintergenicDe novo--Yuen2017 G
YY1P2   2-0002-005chr2:
140168550-140168550
CTintergenicDe novo--Yuen2017 G
YY1P2   2-1323-003chr2:
139779056-139779056
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
YY1P2   2-1269-003chr2:
140101888-140101902
ATGTGTGTGTGTGTGATGTGTGTGTGTGintergenicDe novo--Yuen2017 G
YY1P2   1-0148-005chr2:
140745630-140745630
TCintergenicDe novo--Yuen2017 G
YY1P2   1-0972-003chr2:
140301520-140301520
CTintergenicDe novo--Yuen2017 G
YY1P2   2-1408-003chr2:
140412755-140412755
GTintergenicDe novo--Yuen2017 G
YY1P2   AU071203chr2:
140002667-140002667
ACintergenicDe novo--Yuen2017 G
YY1P2   1-0244-003chr2:
140712476-140712476
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
YY1P2   AU061104chr2:
140329148-140329148
CAintergenicDe novo--Yuen2017 G
YY1P2   AU3721302chr2:
140856828-140856828
GAintergenicDe novo--Yuen2017 G
YY1P2   1-0593-003chr2:
140012317-140012317
GAintergenicDe novo--Yuen2017 G
YY1P2   1-0286-004chr2:
139931853-139931853
CTintergenicDe novo--Yuen2017 G
YY1P2   2-0309-005chr2:
140441350-140441350
TCintergenicDe novo--Yuen2017 G
YY1P2   1-0485-003chr2:
140335990-140335990
AGintergenicDe novo--Yuen2017 G
YY1P2   7-0168-003chr2:
140725055-140725055
ACintergenicDe novo--Yuen2017 G
YY1P2   AU4219302chr2:
140854027-140854027
ACintergenicDe novo--Yuen2017 G
YY1P2   1-0169-004chr2:
139907978-139907978
GAintergenicDe novo--Yuen2017 G
YY1P2   2-1129-003chr2:
140715610-140715610
AGintergenicDe novo--Yuen2017 G
YY1P2   AU0146301chr2:
140746767-140746767
CTintergenicDe novo--Yuen2017 G
YY1P2   AU4433301chr2:
140365470-140365470
TGintergenicDe novo--Yuen2017 G
YY1P2   1-0252-003chr2:
140462791-140462791
TCintergenicDe novo--Yuen2017 G
YY1P2   AU2433303chr2:
140045716-140045716
TCintergenicDe novo--Yuen2017 G
YY1P2   2-1626-003chr2:
139694228-139694228
CAintergenicDe novo--Yuen2017 G
YY1P2   AU4283301chr2:
139906866-139906866
GAintergenicDe novo--Yuen2017 G
YY1P2   2-1329-003chr2:
140730816-140730816
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
YY1P2   1-0572-003chr2:
140124370-140124385
ATGTGTGTGTGTGTGTATGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
YY1P2   AU3997301chr2:
140894917-140894917
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More