or
or
Exact

Results for "PDE4D"

Variant Events: 78

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PDE4D     AU076509chr5:
58816817-58816817
GAintronicDe novo--Yuen2017 G
PDE4D     AU2129301chr5:
59013778-59013784
ATCTTCTATCTintronicDe novo--Yuen2017 G
PDE4D     AU3859301chr5:
59618650-59618650
CTintronicDe novo--Yuen2017 G
PDE4D     7-0100-004chr5:
59447374-59447374
GTintronicDe novo--Yuen2017 G
PDE4D     5-0017-004chr5:
58752684-58752684
CTintronicDe novo--Yuen2017 G
PDE4D     1-0373-003chr5:
58275511-58275511
TGintronicDe novo--Yuen2017 G
PDE4D     2-0135-003chr5:
58739954-58739954
TCintronicDe novo--Yuen2017 G
PDE4D     1-0352-005chr5:
58628180-58628180
ACintronicDe novo--Yuen2017 G
PDE4D     3-0482-000chr5:
58735799-58735799
AGintronicDe novo--Yuen2017 G
PDE4D     AU3713302chr5:
58522735-58522735
GAintronicDe novo--Yuen2017 G
PDE4D     1-0572-003chr5:
59382812-59382812
GAintronicDe novo--Yuen2017 G
PDE4D     1-0382-004chr5:
58374093-58374093
ACintronicDe novo--Yuen2017 G
PDE4D     AU3875301chr5:
58350963-58350963
GCintronicDe novo--Yuen2017 G
PDE4D     11724.p1chr5:
58285584-58285584
CAexonicMosaicstopgainNM_001197222
NM_001197223
NM_001197221
NM_001104631
NM_001197218
NM_001197219
NM_001197220
NM_006203
NM_001165899
c.G778T
c.G577T
c.G544T
c.G1450T
c.G1258T
c.G1084T
c.G1060T
c.G1042T
c.G1267T
p.E260X
p.E193X
p.E182X
p.E484X
p.E420X
p.E362X
p.E354X
p.E348X
p.E423X
38.0-Dou2017 E
PDE4D     2-0144-003chr5:
59277195-59277195
GTintronicDe novo--Yuen2017 G
PDE4D     AU4392302chr5:
58284262-58284262
TCintronicDe novo--Yuen2017 G
PDE4D     1-0181-004chr5:
59746002-59746009
TCAGATACTCAGATACAGATACintronicDe novo--Yuen2017 G
PDE4D     AU3862305chr5:
58993904-58993905
ATAintronicDe novo--Yuen2017 G
PDE4D     AU071204chr5:
59048478-59048478
TGintronicDe novo--Yuen2017 G
PDE4D     AU4199303chr5:
58308965-58308965
AGintronicDe novo--Yuen2017 G
PDE4D     2-1231-003chr5:
58615566-58615566
TCintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4D     2-1509-003chr5:
58731346-58731348
TCCTCintronicDe novo--Yuen2017 G
PDE4D     1-0638-003chr5:
58967815-58967815
CAintronicDe novo--Yuen2017 G
PDE4D     1-0173-004chr5:
59185598-59185600
AGTAintronicDe novo--Yuen2017 G
PDE4D     2-1721-003chr5:
59358477-59358477
GCintronicDe novo--Yuen2017 G
PDE4D     1-0465-003chr5:
59516118-59516118
GAintronicDe novo--Yuen2017 G
PDE4D     1-0571-003chr5:
59696134-59696134
GAintronicDe novo--Yuen2017 G
PDE4D     AU4228301chr5:
58509568-58509568
TCintronicDe novo--Yuen2017 G
PDE4D     AU3646301chr5:
59403270-59403270
CGintronicDe novo--Yuen2017 G
PDE4D     1-0054-004chr5:
59513633-59513633
TCintronicDe novo--Yuen2017 G
PDE4D     1-0206-005chr5:
58957520-58957520
GAintronicDe novo--Yuen2017 G
PDE4D     AU2410301chr5:
58364614-58364614
TAintronicDe novo--Yuen2017 G
PDE4D     AU3903301chr5:
58929206-58929206
AGintronicDe novo--Yuen2017 G
PDE4D     1-0973-003chr5:
59238055-59238055
GAintronicDe novo--Yuen2017 G
PDE4D     3-0080-000chr5:
58522577-58522577
TAintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4D     AU072904chr5:
59691521-59691521
CGintronicDe novo--Yuen2017 G
PDE4D     1-0514-003chr5:
59572182-59572182
CGintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4D     AU2293301chr5:
59243088-59243088
GAintronicDe novo--Yuen2017 G
PDE4D     11341.p1chr5:
58297024-58297024
AGintronicDe novo--Turner2016 G
PDE4D     2-1336-004chr5:
58600221-58600223
CTTCintronicDe novo--Yuen2017 G
PDE4D     1-0935-003chr5:
59383808-59383819
GAAAGAATACTTGintronicDe novo--Yuen2017 G
PDE4D     2-0012-003chr5:
58796981-58796983
TCATintronicDe novo--Yuen2017 G
PDE4D     13393.p1chr5:
58739572-58739572
CTintronicDe novo--Turner2016 G
PDE4D     1-0099-003chr5:
58981584-58981603
TGGAAAGCATGTGTGGGAAATGGAAAintronicDe novo--Yuen2017 G
PDE4D     AU2975301chr5:
58483572-58483572
TCintronicDe novo--Yuen2017 G
PDE4D     3-0446-000chr5:
58596228-58596228
CTintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4D     AU056804chr5:
58299221-58299221
CTintronicDe novo--Yuen2017 G
PDE4D     2-0109-003chr5:
59120190-59120190
TTAGCAintronicDe novo--Yuen2017 G
PDE4D     1-0489-003chr5:
58721221-58721221
GAintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4D     7-0128-003chr5:
58865291-58865291
CTintronicDe novo--Yuen2017 G
PDE4D     1-0507-003chr5:
59343372-59343372
CAintronicDe novo--Yuen2017 G
PDE4D     2-1437-004chr5:
58919470-58919470
AGintronicDe novo--Yuen2017 G
PDE4D     A20chr5:
59680684-59680684
TCintronicDe novo--Wu2018 G
PDE4D     2-1254-003chr5:
59104395-59104395
TCintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4D     2-1437-004chr5:
59411479-59411479
TCintronicDe novo--Yuen2017 G
PDE4D     AU3846302chr5:
58617317-58617317
TCintronicDe novo--Yuen2017 G
PDE4D     2-1290-004chr5:
59636092-59636092
CTintronicDe novo--Yuen2017 G
PDE4D     1-0458-005chr5:
58914276-58914276
CGintronicDe novo--Yuen2017 G
PDE4D     2-1318-004chr5:
58374847-58374847
CTintronicDe novo--Yuen2017 G
PDE4D     2-1120-003chr5:
59452931-59452931
AGintronicDe novo--Yuen2017 G
PDE4D     1-0352-003chr5:
58628180-58628180
ACintronicDe novo--Yuen2016 G
PDE4D     2-1373-003chr5:
59317734-59317734
CTintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4D     5-0087-003chr5:
58422202-58422202
TCintronicDe novo--Yuen2017 G
PDE4D     AU2485305chr5:
59475269-59475269
TGintronicDe novo--Yuen2017 G
PDE4D     AU2022302chr5:
59243126-59243126
GAintronicDe novo--Yuen2017 G
PDE4D     13026.p1chr5:
59736662-59736662
CTintronicDe novo--Werling2018 G
PDE4D     2-1379-003chr5:
58334397-58334397
TCintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4D     AU3782303chr5:
59057146-59057146
TCintronicDe novo--Yuen2017 G
PDE4D     AU4467302chr5:
59461967-59461967
GCintronicDe novo--Yuen2017 G
PDE4D     2-1174-005Bchr5:
59303877-59303877
CCTATAAGATATAAGATATATAAGATAintronicDe novo--Yuen2017 G
PDE4D     2-1291-003chr5:
58303287-58303287
CAintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4D     5-0109-003chr5:
59743408-59743408
CTintronicDe novo--Yuen2017 G
PDE4D     AU1988302chr5:
58463257-58463257
TCintronicDe novo--Yuen2017 G
PDE4D     1-0512-003chr5:
58893353-58893370
AAGAGAGAGAGAGAGAGAAAGAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
PDE4D     2-1222-003chr5:
59509341-59509341
GAintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4D     AU1698302chr5:
58683685-58683685
AGintronicDe novo--Yuen2017 G
PDE4D     AU3859301chr5:
58490800-58490800
TGintronicDe novo--Yuen2017 G
PDE4D     1-0487-003chr5:
59282723-59282723
CGintronicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More