or
or
Exact

Results for "COMMD10"

Variant Events: 39

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
COMMD10     AU2029301chr5:
115686223-115686223
GAintergenicDe novo--Yuen2017 G
COMMD10     1-0494-003chr5:
115614884-115614884
GAintronicDe novo--Yuen2017 G
COMMD10     5-0026-003chr5:
115581517-115581517
TTTCintronicDe novo--Yuen2017 G
COMMD10     1-0065-005chr5:
115560196-115560196
AGintronicDe novo--Yuen2017 G
COMMD10     7-0100-004chr5:
115661525-115661525
GAintergenicDe novo--Yuen2017 G
COMMD10     2-1591-003chr5:
115442584-115442584
GAintronicDe novo--Yuen2017 G
COMMD10     3-0169-000chr5:
115480232-115480232
AATintronicDe novo--Yuen2016 G
COMMD10     2-1626-003chr5:
115463634-115463640
TAAAAAATAAAintronicDe novo--Yuen2017 G
COMMD10     2-1369-003chr5:
115621904-115621910
CCTCTCTCCTCTintronicDe novo--Yuen2017 G
COMMD10     AU050603chr5:
115530478-115530478
AGintronicDe novo--Yuen2017 G
COMMD10     2-0145-004chr5:
115660554-115660554
TCintergenicDe novo--Yuen2017 G
COMMD10     2-0310-004chr5:
115477939-115477939
ATintronicDe novo--Yuen2017 G
COMMD10     1-0965-003chr5:
115543334-115543334
TCintronicDe novo--Yuen2017 G
COMMD10     2-1386-003chr5:
115536240-115536240
AGintronicDe novo--Yuen2016 G
Yuen2017 G
COMMD10     AU4223302chr5:
115487135-115487135
CAintronicDe novo--Yuen2017 G
COMMD10     1-0440-003chr5:
115566274-115566274
CGintronicDe novo--Yuen2017 G
COMMD10     AU2072302chr5:
115573619-115573627
TGTCGTCGTTGTCGTintronicDe novo--Yuen2017 G
COMMD10     AU4186302chr5:
115644782-115644782
TGintergenicDe novo--Yuen2017 G
COMMD10     1-0901-003chr5:
115664452-115664452
ACintergenicDe novo--Yuen2017 G
COMMD10     2-0132-004chr5:
115634120-115634120
GAintergenicDe novo--Yuen2017 G
COMMD10     13568.p1chr5:
115517213-115517213
AATintronicDe novo--Werling2018 G
COMMD10     1-0104-004chr5:
115540077-115540077
GTintronicDe novo--Yuen2017 G
COMMD10     1-0210-004chr5:
115617707-115617707
AGintronicDe novo--Yuen2017 G
COMMD10     1-0494-003Achr5:
115614884-115614884
GAintronicDe novo--Yuen2017 G
COMMD10     1-0745-003chr5:
115463962-115463962
CGintronicDe novo--Yuen2017 G
COMMD10     2-1506-003chr5:
115434843-115434843
CTintronicDe novo--Yuen2017 G
COMMD10     1-0022-004chr5:
115467102-115467129
GTGTATGTATGTATGTATGTATGTATGTGTGTATGTATGTATGTATGTATGTintronicDe novo--Yuen2017 G
COMMD10     AU3777301chr5:
115585072-115585072
CTintronicDe novo--Yuen2017 G
COMMD10     5-0055-004chr5:
115502203-115502206
GCCTGintronicDe novo--Yuen2017 G
COMMD10     A30chr5:
115427891-115427891
AGintronicDe novo--Wu2018 G
COMMD10     1-0359-003chr5:
115521842-115521842
GAintronicDe novo--Yuen2017 G
COMMD10     1-0357-003chr5:
115666493-115666493
GAintergenicDe novo--Yuen2017 G
COMMD10     2-1129-003chr5:
115669112-115669112
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
COMMD10     2-1402-003chr5:
115639973-115639973
ACintergenicDe novo--Yuen2017 G
COMMD10     AU054304chr5:
115495908-115495908
GAintronicDe novo--Yuen2017 G
COMMD10     1-0200-004chr5:
115445782-115445782
TGintronicDe novo--Yuen2017 G
COMMD10     AU057404chr5:
115517107-115517107
CTintronicDe novo--Yuen2017 G
COMMD10     7-0140-003chr5:
115644361-115644361
CTintergenicDe novo--Yuen2017 G
COMMD10     AU3915301chr5:
115485555-115485555
TAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More