or
or
Exact

Results for "CCSER1"

Variant Events: 123

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CCSER1     2-1342-003chr4:
91080353-91080374
TTTATTATTATTATTATTATTATTTATTATTATTATTATTAintronicDe novo--Yuen2017 G
CCSER1     7-0135-003chr4:
92375550-92375550
AGintronicDe novo--Yuen2017 G
CCSER1     3-0456-000chr4:
92633846-92633849
CTATCTATATintergenicDe novo--Yuen2017 G
CCSER1     2-0135-003chr4:
92636716-92636716
TTAintergenicDe novo--Yuen2017 G
CCSER1     AU2035301chr4:
92567934-92567934
AGintergenicDe novo--Yuen2017 G
CCSER1     1-0465-003achr4:
91552433-91552433
AGintronicDe novo--Yuen2017 G
CCSER1     2-1635-004chr4:
91293638-91293638
GCintronicDe novo--Yuen2017 G
CCSER1     AU072004chr4:
92726309-92726309
TCintergenicDe novo--Yuen2017 G
CCSER1     1-0640-003chr4:
91272386-91272388
ATTATintronicDe novo--Yuen2017 G
CCSER1     12568.p1chr4:
91309989-91309989
TCintronicDe novo--Turner2016 G
CCSER1     AU2248302chr4:
91871113-91871113
GAintronicDe novo--Yuen2017 G
CCSER1     12680.p1chr4:
91309992-91309992
GAintronicDe novo--Turner2016 G
CCSER1     AU2108302chr4:
92297994-92297994
GTintronicDe novo--Yuen2017 G
CCSER1     12793.p1chr4:
91993119-91993119
AGintronicDe novo--Turner2016 G
CCSER1     12680.p1chr4:
91309989-91309989
TCintronicDe novo--Turner2016 G
CCSER1     12568.p1chr4:
91309992-91309992
GAintronicDe novo--Turner2016 G
CCSER1     AU3721301chr4:
92478874-92478874
CTintronicDe novo--Yuen2017 G
CCSER1     1-0440-003chr4:
92563941-92563941
CTintergenicDe novo--Yuen2017 G
CCSER1     2-0304-004chr4:
92616662-92616662
GCintergenicDe novo--Yuen2017 G
CCSER1     AU3808305chr4:
92543021-92543021
TCintergenicDe novo--Yuen2017 G
CCSER1     3-0438-000chr4:
92118966-92118966
CTintronicDe novo--Yuen2016 G
CCSER1     200675527@1082035040chr4:
91234171-91234171
TAexonicDe novosynonymous SNVNM_001145065
NM_207491
c.T1482A
c.T1482A
p.G494G
p.G494G
--Satterstrom2020 E
CCSER1     AU1988301chr4:
93087930-93087930
CTintergenicDe novo--Yuen2017 G
CCSER1     AU3052301chr4:
91535721-91535723
TGGTGintronicDe novo--Yuen2017 G
CCSER1     2-1306-003chr4:
91215915-91215915
CCATGintronicDe novo--Yuen2017 G
CCSER1     AU4122301chr4:
91078286-91078286
CTintronicDe novo--Yuen2017 G
CCSER1     AU3794301chr4:
93088484-93088484
TCintergenicDe novo--Yuen2017 G
CCSER1     A22chr4:
93177664-93177664
TCintergenicDe novo--Wu2018 G
CCSER1     2-1317-003chr4:
92817484-92817484
AGintergenicDe novo--Yuen2017 G
CCSER1     2-1430-003chr4:
92431839-92431839
TCintronicDe novo--Yuen2016 G
Yuen2017 G
CCSER1     1-0065-005chr4:
92454018-92454018
CTintronicDe novo--Yuen2017 G
CCSER1     1-0338-005chr4:
93178071-93178071
TGintergenicDe novo--Yuen2017 G
CCSER1     7-0219-003chr4:
91223769-91223769
TCintronicDe novo--Yuen2017 G
CCSER1     3-0456-000Bchr4:
92633846-92633849
CTATCTATATintergenicDe novo--Yuen2017 G
CCSER1     1-0874-003chr4:
92000191-92000191
GAintronicDe novo--Yuen2017 G
CCSER1     AU4070301chr4:
92191229-92191229
ATintronicDe novo--Yuen2017 G
CCSER1     AU4212303chr4:
91528151-91528151
ATintronicDe novo--Yuen2017 G
CCSER1     2-0145-003chr4:
92896421-92896421
GTintergenicDe novo--Yuen2017 G
CCSER1     A9chr4:
91489672-91489672
ATintronicDe novo--Wu2018 G
CCSER1     3-0456-000Bchr4:
92880411-92880412
TATAAintergenicDe novo--Yuen2017 G
CCSER1     NDAR_INVCX994GUN_wes1chr4:
91549237-91549237
CTexonicDe novostopgainNM_001145065
NM_207491
c.C1786T
c.C1786T
p.R596X
p.R596X
18.08.284E-6DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
CCSER1     2-1617-003chr4:
92015850-92015850
CTintronicDe novo--Yuen2017 G
CCSER1     2-1362-003chr4:
92294964-92294964
GAintronicDe novo--Yuen2017 G
CCSER1     2-1362-003chr4:
91657348-91657348
GAintronicDe novo--Yuen2017 G
CCSER1     AU3951301chr4:
92335778-92335778
AGintronicDe novo--Yuen2017 G
CCSER1     2-0057-004chr4:
92813750-92813750
CTintergenicDe novo--Yuen2017 G
CCSER1     2-0135-004chr4:
92416142-92416142
CTintronicDe novo--Yuen2017 G
CCSER1     1-0413-003chr4:
92163059-92163059
AGintronicDe novo--Yuen2016 G
Yuen2017 G
CCSER1     1-0045-004chr4:
92772722-92772722
GCintergenicDe novo--Yuen2017 G
CCSER1     AU2035302chr4:
92567934-92567934
AGintergenicDe novo--Yuen2017 G
CCSER1     1-0651-003chr4:
91559616-91559616
TCintronicDe novo--Yuen2017 G
CCSER1     AU3725302chr4:
92205455-92205463
ACTTCTTCTACTTCTintronicDe novo--Yuen2017 G
CCSER1     7-0168-003chr4:
92379704-92379704
GCintronicDe novo--Yuen2017 G
CCSER1     2-1693-003chr4:
93032556-93032556
CGintergenicDe novo--Yuen2017 G
CCSER1     AU2075302chr4:
92866308-92866308
GAintergenicDe novo--Yuen2017 G
CCSER1     1-0028-003chr4:
92582239-92582239
GTintergenicDe novo--Yuen2017 G
CCSER1     1-0512-003chr4:
91800618-91800634
TATAATAATAATAATAATATAATAATAATAAintronicDe novo--Yuen2017 G
CCSER1     7-0008-003chr4:
93133892-93133892
CGintergenicDe novo--Yuen2017 G
CCSER1     1-0184-003chr4:
92988401-92988419
CAATAAATAAATAAATAAACAATAAATAAATAAAintergenicDe novo--Yuen2017 G
CCSER1     AU3398301chr4:
92769858-92769858
GAintergenicDe novo--Yuen2017 G
CCSER1     AU054103chr4:
92710027-92710027
CCATTTTTTTAintergenicDe novo--Yuen2017 G
CCSER1     2-1138-003chr4:
92303434-92303434
CTintronicDe novo--Yuen2017 G
CCSER1     2-1627-003chr4:
92895208-92895208
CAintergenicDe novo--Yuen2017 G
CCSER1     AU046706chr4:
91996645-91996645
TCintronicDe novo--Yuen2017 G
CCSER1     AU3517302chr4:
92870267-92870267
GAintergenicDe novo--Yuen2017 G
CCSER1     7-0161-003chr4:
91258380-91258380
CTintronicDe novo--Yuen2017 G
CCSER1     2-0028-003chr4:
91575869-91575869
TAintronicDe novo--Yuen2017 G
CCSER1     1-0052-004chr4:
92291716-92291716
CAintronicDe novo--Yuen2017 G
CCSER1     AU4246304chr4:
91824258-91824258
GAintronicDe novo--Yuen2017 G
CCSER1     1-0572-003chr4:
91671183-91671183
CTintronicDe novo--Yuen2017 G
CCSER1     AU1987302chr4:
92221591-92221591
ACintronicDe novo--Yuen2017 G
CCSER1     1-0539-003chr4:
91199340-91199340
ATintronicDe novo--Yuen2017 G
CCSER1     2-1455-003chr4:
92158027-92158027
TCintronicDe novo--Yuen2017 G
CCSER1     5-0106-003chr4:
91485541-91485541
ATintronicDe novo--Yuen2017 G
CCSER1     AU2711303chr4:
92892306-92892306
CTintergenicDe novo--Yuen2017 G
CCSER1     2-1306-004chr4:
91215915-91215915
CCATGintronicDe novo--Yuen2017 G
CCSER1     1-0215-006chr4:
92199293-92199293
TCintronicDe novo--Yuen2017 G
CCSER1     2-1460-003chr4:
91116800-91116800
CAintronicDe novo--Yuen2017 G
CCSER1     AU4429301chr4:
92736626-92736627
ATAintergenicDe novo--Yuen2017 G
CCSER1     1-0357-003chr4:
93102672-93102682
TATGAGCCAGCTintergenicDe novo--Yuen2017 G
CCSER1     1-0465-003chr4:
91552433-91552433
AGintronicDe novo--Yuen2017 G
CCSER1     7-0035-003chr4:
92040271-92040271
ACintronicDe novo--Yuen2017 G
CCSER1     AU3646301chr4:
92488903-92488903
GAintronicDe novo--Yuen2017 G
CCSER1     2-0003-003chr4:
92063553-92063553
TCintronicDe novo--Yuen2017 G
CCSER1     2-0297-003chr4:
91676137-91676137
AGintronicDe novo--Yuen2017 G
CCSER1     AU2787302chr4:
93093385-93093385
CGintergenicDe novo--Yuen2017 G
CCSER1     AU4089301chr4:
92752136-92752136
GTintergenicDe novo--Yuen2017 G
CCSER1     AU3720302chr4:
91536113-91536113
AGintronicDe novo--Yuen2017 G
CCSER1     AU3720302chr4:
92861750-92861750
TAintergenicDe novo--Yuen2017 G
CCSER1     AU072904chr4:
93108336-93108336
GCintergenicDe novo--Yuen2017 G
CCSER1     2-0307-004chr4:
92893891-92893902
GAGCCAGTTTTTGintergenicDe novo--Yuen2017 G
CCSER1     2-1230-003chr4:
92927702-92927702
TCintergenicDe novo--Yuen2017 G
CCSER1     2-1330-003chr4:
92421509-92421509
AGintronicDe novo--Yuen2016 G
Yuen2017 G
CCSER1     AU072504chr4:
92140687-92140687
CTintronicDe novo--Yuen2017 G
CCSER1     1-0295-003chr4:
92991826-92991826
CTintergenicDe novo--Yuen2017 G
CCSER1     1-0632-003chr4:
93144460-93144460
TCintergenicDe novo--Yuen2017 G
CCSER1     AU3057302chr4:
92634296-92634296
CTintergenicDe novo--Yuen2017 G
CCSER1     1-0126-004chr4:
91745925-91745925
GAintronicDe novo--Yuen2017 G
CCSER1     3-0456-000 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
CCSER1     12738.p1chr4:
91538812-91538812
GTintronicDe novo--Werling2018 G
CCSER1     AU045010chr4:
92789695-92789695
ACintergenicDe novo--Yuen2017 G
CCSER1     1-0841-003chr4:
92849593-92849593
CGintergenicDe novo--Yuen2017 G
CCSER1     iHART2410chr4:
91229448-91229448
GTexonicPaternalstopgainNM_001145065
NM_207491
c.G13T
c.G13T
p.G5X
p.G5X
38.0-Ruzzo2019 G
CCSER1     1-0772-003chr4:
92561601-92561601
GTintergenicDe novo--Yuen2017 G
CCSER1     3-0431-000chr4:
91959873-91959873
CGintronicDe novo--Yuen2016 G
Yuen2017 G
CCSER1     iHART2409chr4:
91229448-91229448
GTexonicPaternalstopgainNM_001145065
NM_207491
c.G13T
c.G13T
p.G5X
p.G5X
38.0-Ruzzo2019 G
CCSER1     1-0141-003chr4:
91231769-91231769
GTintronicDe novo--Yuen2017 G
CCSER1     AU3729301chr4:
92566876-92566876
TCintergenicDe novo--Yuen2017 G
CCSER1     iHART2412chr4:
91229448-91229448
GTexonicPaternalstopgainNM_001145065
NM_207491
c.G13T
c.G13T
p.G5X
p.G5X
38.0-Ruzzo2019 G
CCSER1     iHART2411chr4:
91229448-91229448
GTexonicPaternalstopgainNM_001145065
NM_207491
c.G13T
c.G13T
p.G5X
p.G5X
38.0-Ruzzo2019 G
CCSER1     AU3702307chr4:
91825820-91825820
GAintronicDe novo--Yuen2017 G
CCSER1     1-0092-004chr4:
92991400-92991400
CCCATintergenicDe novo--Yuen2017 G
CCSER1     AU1933302chr4:
91413665-91413665
CTintronicDe novo--Yuen2017 G
CCSER1     1-0593-003chr4:
92721297-92721297
TCintergenicDe novo--Yuen2017 G
CCSER1     1-0272-003chr4:
91543068-91543068
TGintronicDe novo--Yuen2017 G
CCSER1     AU4347301chr4:
91761365-91761365
TCintronicDe novo--Yuen2017 G
CCSER1     2-1280-003chr4:
92368800-92368805
GTTTTTGTTTintronicDe novo--Yuen2017 G
CCSER1     2-1511-003chr4:
91748402-91748402
CTintronicDe novo--Yuen2017 G
CCSER1     AU3787302chr4:
91693554-91693560
CATTATTCATTintronicDe novo--Yuen2017 G
CCSER1     2-1148-004chr4:
91936101-91936101
GGATTCCTintronicDe novo--Yuen2017 G
CCSER1     1-0579-003chr4:
91877137-91877150
TTATATATATATATTTATATATATATintronicDe novo--Yuen2017 G
CCSER1     2-1526-003chr4:
91066196-91066196
AGintronicDe novo--Yuen2017 G
CCSER1     1-0736-003chr4:
92740868-92740873
TCTCCTTCTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More