or
or
Exact

Results for "ICOS"

Variant Events: 31

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ICOS     1-0300-003chr2:
205329079-205329079
AACCATTGACintergenicDe novo--Yuen2017 G
ICOS     2-0022-003chr2:
205034349-205034349
TCintergenicDe novo--Yuen2017 G
ICOS     1-0627-003chr2:
204868411-204868411
AGintergenicDe novo--Yuen2017 G
ICOS     AU009904chr2:
205083517-205083517
GTintergenicDe novo--Yuen2017 G
ICOS     AU3721301chr2:
204877135-204877135
CTintergenicDe novo--Yuen2017 G
ICOS     1-0401-003chr2:
204960493-204960493
GCintergenicDe novo--Yuen2017 G
ICOS     AU4191302chr2:
205116683-205116683
CTintergenicDe novo--Yuen2017 G
ICOS     1-0285-003chr2:
205329079-205329079
AACCATTGACintergenicDe novo--Yuen2017 G
ICOS     AU4359301chr2:
204983502-204983533
CTGTGTGTGTGTGTGTATGTGTGTGTGTGTGTCTGTGTGTGTGTGTATGTGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
ICOS     1-0214-003chr2:
205005168-205005168
GAintergenicDe novo--Yuen2017 G
ICOS     1-0338-003chr2:
205271651-205271651
CAintergenicDe novo--Yuen2017 G
ICOS     2-1237-003chr2:
204815889-204815889
GAintronicDe novo--Yuen2017 G
ICOS     1-0006-004chr2:
205163941-205163941
TCintergenicDe novo--Yuen2017 G
ICOS     1-0006-004chr2:
205389483-205389483
GAintergenicDe novo--Yuen2017 G
ICOS     1-0107-003chr2:
205400994-205401011
CAGAGAGAGAGAGAGAGACAGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
ICOS     AU3398301chr2:
205162267-205162267
GAintergenicDe novo--Yuen2017 G
ICOS     AU002903chr2:
205015888-205015888
GCintergenicDe novo--Yuen2017 G
ICOS     AU047703chr2:
204878696-204878696
CGintergenicDe novo--Yuen2017 G
ICOS     12498.p1chr2:
205330851-205330851
TGintergenicDe novo--Turner2016 G
ICOS     AU4263304chr2:
204982260-204982260
CTintergenicDe novo--Yuen2017 G
ICOS     AU005213chr2:
204875651-204875651
TAintergenicDe novo--Yuen2017 G
ICOS     2-1266-003chr2:
205400994-205401011
CAGAGAGAGAGAGAGAGACAGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
ICOS     1-0265-004chr2:
205247746-205247750
ATCTGAintergenicDe novo--Yuen2017 G
ICOS     1-0065-005chr2:
204856366-204856366
GTintergenicDe novo--Yuen2017 G
ICOS     2-1416-004chr2:
204944952-204944952
TCintergenicDe novo--Yuen2017 G
ICOS     14465.p1chr2:
205212143-205212143
CCTintergenicDe novo--Werling2018 G
ICOS     2-1297-003chr2:
204944271-204944271
GGTATCintergenicDe novo--Yuen2017 G
ICOS     2-1416-003chr2:
204944952-204944952
TCintergenicDe novo--Yuen2017 G
ICOS     7-0129-003chr2:
204843139-204843139
ATintergenicDe novo--Yuen2017 G
ICOS     AU3918301chr2:
205084711-205084711
CTintergenicDe novo--Yuen2017 G
ICOS     AU065807chr2:
205072294-205072294
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More