or
or
Exact

Results for "LCORL"

Variant Events: 116

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LCORL     1-0533-003chr4:
18249637-18249637
CGintergenicDe novo--Yuen2017 G
LCORL     AU011903chr4:
19075731-19075731
AGintergenicDe novo--Yuen2017 G
LCORL     AU4283301chr4:
18926771-18926773
TGGTGintergenicDe novo--Yuen2017 G
LCORL     AU3905302chr4:
19761741-19761741
GAintergenicDe novo--Yuen2017 G
LCORL     1-0358-003chr4:
19809920-19809920
AGintergenicDe novo--Yuen2017 G
LCORL     AU057405chr4:
19613306-19613306
GAintergenicDe novo--Yuen2017 G
LCORL     2-1626-003chr4:
17846581-17846585
CTTTTCTTUTR3De novo--Yuen2017 G
LCORL     7-0100-004chr4:
18162679-18162679
AATTGGintergenicDe novo--Yuen2017 G
LCORL     AU2139301chr4:
18668615-18668615
AGintergenicDe novo--Yuen2017 G
LCORL     AU4473301chr4:
19809704-19809704
GAintergenicDe novo--Yuen2017 G
LCORL     AU047704chr4:
19070161-19070161
GCintergenicDe novo--Yuen2017 G
LCORL     2-0240-004chr4:
18320939-18320939
GAintergenicDe novo--Yuen2017 G
LCORL     AU0540301chr4:
17982221-17982223
CAACAAAAintronicDe novo--Yuen2017 G
LCORL     AU3695303chr4:
19085666-19085666
TCintergenicDe novo--Yuen2017 G
LCORL     2-1690-003chr4:
19483231-19483231
GAintergenicDe novo--Yuen2017 G
LCORL     AU2427302chr4:
18660377-18660377
TAintergenicDe novo--Yuen2017 G
LCORL     AU3858303chr4:
19594938-19594938
ACintergenicDe novo--Yuen2017 G
LCORL     AU3721301chr4:
19438407-19438407
ATintergenicDe novo--Yuen2017 G
LCORL     7-0002-003chr4:
18089267-18089267
AGintergenicDe novo--Yuen2017 G
LCORL     2-1721-003chr4:
18604435-18604435
AGintergenicDe novo--Yuen2017 G
LCORL     AU2495302chr4:
19587538-19587539
ACACCintergenicDe novo--Yuen2017 G
LCORL     1-0862-003chr4:
18747611-18747611
CCTTintergenicDe novo--Yuen2017 G
LCORL     2-1333-003chr4:
18646739-18646739
CAintergenicDe novo--Yuen2017 G
LCORL     14139.p1chr4:
19481652-19481652
CTintergenicUnknown--Werling2018 G
LCORL     1-0469-003chr4:
19018296-19018296
GAintergenicDe novo--Yuen2017 G
LCORL     2-1370-003chr4:
18150755-18150755
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
LCORL     AU4260303chr4:
18200262-18200262
TGintergenicDe novo--Yuen2017 G
LCORL     1-0777-003chr4:
18980832-18980832
TAintergenicDe novo--Yuen2017 G
LCORL     NDAR_INVLR562GF7_wes1chr4:
17887689-17887689
ACsplicingDe novosplicing19.736.688E-5Lim2017 E
LCORL     2-1562-004chr4:
18505870-18505870
CAintergenicDe novo--Yuen2017 G
LCORL     2-1350-004chr4:
20040960-20040960
AGintergenicDe novo--Yuen2017 G
LCORL     AU079104chr4:
19328008-19328008
TCintergenicDe novo--Yuen2017 G
LCORL     AU4032306chr4:
18238196-18238196
GTintergenicDe novo--Yuen2017 G
LCORL     7-0032-003chr4:
17908740-17908753
CCCTCTAACCTCTACCCTCTAintronicDe novo--Yuen2017 G
LCORL     2-1242-003chr4:
19926811-19926811
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
LCORL     AU075210chr4:
19916792-19916792
CTintergenicDe novo--Yuen2017 G
LCORL     AU046703chr4:
18525148-18525148
TCintergenicDe novo--Yuen2017 G
LCORL     1-0303-003chr4:
18891453-18891453
GAintergenicDe novo--Yuen2017 G
LCORL     2-0300-004chr4:
18672067-18672067
CTintergenicDe novo--Yuen2017 G
LCORL     AU3645301chr4:
19024492-19024494
ATTATintergenicDe novo--Yuen2017 G
LCORL     AU2109301chr4:
19195475-19195475
CTintergenicDe novo--Yuen2017 G
LCORL     1-0413-003chr4:
18562143-18562143
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LCORL     2-1357-003chr4:
18112979-18112979
AGintergenicDe novo--Yuen2017 G
LCORL     AU071703chr4:
20022186-20022186
TGintergenicDe novo--Yuen2017 G
LCORL     1-0651-003 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
LCORL     3-0185-000chr4:
19844023-19844023
ACintergenicDe novo--Yuen2017 G
LCORL     AU4467302chr4:
19710561-19710561
AGintergenicDe novo--Yuen2017 G
LCORL     1-0007-003chr4:
18748664-18748664
GAintergenicDe novo--Yuen2017 G
LCORL     2-1341-003chr4:
19078317-19078317
GAintergenicDe novo--Yuen2017 G
LCORL     5-0128-003chr4:
18986091-18986091
CTintergenicDe novo--Yuen2017 G
LCORL     1-0755-003chr4:
19924919-19924919
AGintergenicDe novo--Yuen2017 G
LCORL     AU006804chr4:
18537214-18537214
TCintergenicDe novo--Yuen2017 G
LCORL     7-0168-003chr4:
17872018-17872018
CTintronicDe novo--Yuen2017 G
LCORL     1-0445-003chr4:
19832744-19832744
GAintergenicDe novo--Yuen2017 G
LCORL     1-0591-003chr4:
19370931-19370931
GAintergenicDe novo--Yuen2017 G
LCORL     AU2793301chr4:
19336756-19336756
AGintergenicDe novo--Yuen2017 G
LCORL     1-0668-003chr4:
18285885-18285886
ACACCintergenicDe novo--Yuen2017 G
LCORL     1-0483-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
LCORL     2-1345-003chr4:
18278121-18278121
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LCORL     11336.p1chr4:
18421033-18421033
CTintergenicDe novo--Werling2018 G
LCORL     2-1272-003chr4:
19273319-19273319
GCintergenicDe novo--Yuen2016 G
LCORL     AU3051302chr4:
20072721-20072721
GAintergenicDe novo--Yuen2017 G
LCORL     AU3057301chr4:
19491926-19491929
ATTTAintergenicDe novo--Yuen2017 G
LCORL     AU4246304chr4:
19292017-19292017
CTintergenicDe novo--Yuen2017 G
LCORL     AU4429301chr4:
19998331-19998331
AGintergenicDe novo--Yuen2017 G
LCORL     13251.p1chr4:
19542959-19542959
ATintergenicDe novo--Wilfert2021 G
LCORL     AU071804chr4:
18336027-18336027
GAintergenicDe novo--Yuen2017 G
LCORL     1-0458-003chr4:
19257562-19257562
GAintergenicDe novo--Yuen2017 G
LCORL     2-1189-003chr4:
19103401-19103401
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
LCORL     AU078503chr4:
19303309-19303309
GAintergenicDe novo--Yuen2017 G
LCORL     AU3913303chr4:
18419998-18420000
CGGCGintergenicDe novo--Yuen2017 G
LCORL     AU045512chr4:
19080627-19080627
AGintergenicDe novo--Yuen2017 G
LCORL     AU4029302chr4:
20083135-20083135
ATintergenicDe novo--Yuen2017 G
LCORL     AU015903chr4:
18778204-18778204
AGintergenicDe novo--Yuen2017 G
LCORL     AU1308303chr4:
19401019-19401019
TCintergenicDe novo--Yuen2017 G
LCORL     2-1689-003chr4:
19561748-19561748
TCintergenicDe novo--Yuen2017 G
LCORL     2-0006-004chr4:
18856686-18856686
GAintergenicDe novo--Yuen2017 G
LCORL     AU2100302chr4:
18280430-18280430
CTintergenicDe novo--Yuen2017 G
LCORL     AU2100302chr4:
19440092-19440092
TCintergenicDe novo--Yuen2017 G
LCORL     12185.p1chr4:
18310822-18310822
CTintergenicDe novo--Werling2018 G
LCORL     AU3052303chr4:
20066623-20066623
GTintergenicDe novo--Yuen2017 G
LCORL     5-0061-003chr4:
19349655-19349655
AGintergenicDe novo--Yuen2017 G
LCORL     2-0272-004chr4:
18785819-18785819
GTintergenicDe novo--Yuen2017 G
LCORL     AU4468301chr4:
19140420-19140420
GCintergenicDe novo--Yuen2017 G
LCORL     1-0912-003chr4:
20066774-20066774
CTintergenicDe novo--Yuen2017 G
LCORL     AU4013303chr4:
19712026-19712026
ATintergenicDe novo--Yuen2017 G
LCORL     1-0868-003chr4:
17977542-17977542
AGintronicDe novo--Yuen2017 G
LCORL     2-1416-004chr4:
18590891-18590891
TCintergenicDe novo--Yuen2017 G
LCORL     1-0032-003chr4:
18135425-18135425
TCintergenicDe novo--Yuen2017 G
LCORL     1-0868-003chr4:
17977246-17977246
TCintronicDe novo--Yuen2017 G
LCORL     2-0223-003chr4:
18001284-18001284
ATintronicDe novo--Yuen2017 G
LCORL     1-0295-003chr4:
19855511-19855511
CTintergenicDe novo--Yuen2017 G
LCORL     AU3190305chr4:
17938970-17938970
TCintronicDe novo--Yuen2017 G
LCORL     A32chr4:
18624564-18624568
TAGTATintergenicDe novo--Wu2018 G
LCORL     2-0244-004chr4:
18861633-18861633
TCintergenicDe novo--Yuen2017 G
LCORL     1-0568-003chr4:
18314772-18314772
AGintergenicDe novo--Yuen2017 G
LCORL     AU066104chr4:
19793400-19793400
CTintergenicDe novo--Yuen2017 G
LCORL     AU4250301chr4:
18914222-18914222
GTintergenicDe novo--Yuen2017 G
LCORL     AU3154302chr4:
18251607-18251607
GAintergenicDe novo--Yuen2017 G
LCORL     2-1430-003chr4:
18046962-18046962
CAintergenicDe novo--Yuen2017 G
LCORL     1-0321-004chr4:
18089769-18089769
AGintergenicDe novo--Yuen2017 G
LCORL     1-0518-003chr4:
19764418-19764418
CTintergenicDe novo--Yuen2017 G
LCORL     AU4069302chr4:
19080627-19080627
AGintergenicDe novo--Yuen2017 G
LCORL     2-1511-003chr4:
19043674-19043692
GTTATTTATTTATTTATTTGTTATTTATTTATTTintergenicDe novo--Yuen2017 G
LCORL     111289chr4:
17910885-17910885
AGexonicnonsynonymous SNVNM_001166139
NM_153686
c.T514C
c.T514C
p.Y172H
p.Y172H
22.1-Woodbury-Smith2022 E
LCORL     1-0339-004chr4:
18256723-18256723
TTTCTACTTTTAintergenicDe novo--Yuen2017 G
LCORL     2-0197-004chr4:
20026050-20026050
TCintergenicDe novo--Yuen2017 G
LCORL     2-1176-003chr4:
19390129-19390129
TTACCintergenicDe novo--Yuen2017 G
LCORL     AU3885305chr4:
18266122-18266122
ATintergenicDe novo--Yuen2017 G
LCORL     2-0297-004chr4:
20007381-20007381
GAintergenicDe novo--Yuen2017 G
LCORL     2-1521-003chr4:
19100827-19100827
GAintergenicDe novo--Yuen2017 G
LCORL     AU3638302chr4:
19999168-19999168
GTintergenicDe novo--Yuen2017 G
LCORL     1-0736-003chr4:
19399320-19399320
GCintergenicDe novo--Yuen2017 G
LCORL     2-1702-003chr4:
18143007-18143007
GAintergenicDe novo--Yuen2017 G
LCORL     AU073006chr4:
19905296-19905296
ACintergenicDe novo--Yuen2017 G
LCORL     AU4033303chr4:
19358250-19358250
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More