or
or
Exact

Results for "SLC35F1"

Variant Events: 27

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SLC35F1     2-0116-004chr6:
118659686-118659686
TTTGAAintergenicDe novo--Yuen2017 G
SLC35F1     1-0028-003chr6:
118780724-118780724
TGintergenicDe novo--Yuen2017 G
SLC35F1     A8chr6:
118405479-118405479
CTintronicDe novo--Wu2018 G
SLC35F1     1-0820-003chr6:
118700598-118700598
GAintergenicDe novo--Yuen2017 G
SLC35F1     2-1066-003chr6:
118420063-118420063
TAintronicDe novo--Yuen2017 G
SLC35F1     AU2787301chr6:
118741869-118741869
GAintergenicDe novo--Yuen2017 G
SLC35F1     2-1303-003chr6:
118734077-118734077
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
SLC35F1     AU030703chr6:
118400390-118400402
TCTCTACTCTACTTCTCTACTintronicDe novo--Yuen2017 G
SLC35F1     2-0022-003chr6:
118295354-118295354
AGintronicDe novo--Yuen2017 G
SLC35F1     AU4315302chr6:
118687574-118687574
TTTTAGintergenicDe novo--Yuen2017 G
SLC35F1     3-0111-000chr6:
118512249-118512249
CTintronicDe novo--Yuen2016 G
SLC35F1     1-0914-003chr6:
118636748-118636748
AGUTR3De novo--Yuen2017 G
SLC35F1     2-1166-003chr6:
118332706-118332706
AGintronicDe novo--Yuen2016 G
Yuen2017 G
SLC35F1     1-0914-003chr6:
118636764-118636764
AGUTR3De novo--Yuen2017 G
SLC35F1     1-0914-003chr6:
118636757-118636757
GTUTR3De novo--Yuen2017 G
SLC35F1     1-0914-003chr6:
118636751-118636751
TCUTR3De novo--Yuen2017 G
SLC35F1     2-0022-004chr6:
118744891-118744891
CTintergenicDe novo--Yuen2017 G
SLC35F1     1-0259-005chr6:
118425969-118425969
CTintronicDe novo--Yuen2017 G
SLC35F1     2-1169-004chr6:
118263728-118263728
TGintronicDe novo--Yuen2017 G
SLC35F1     2-0296-003chr6:
118659686-118659686
TTTGAAintergenicDe novo--Yuen2017 G
SLC35F1     AU3506303chr6:
118706452-118706452
CTintergenicDe novo--Yuen2017 G
SLC35F1     AU070007chr6:
118586539-118586539
AGintronicDe novo--Yuen2017 G
SLC35F1     AU4250301chr6:
118576153-118576153
CGintronicDe novo--Yuen2017 G
SLC35F1     1-0991-003chr6:
118350530-118350546
TGAGAGAGAGAGAGAGATGAGAGAGAGAGAintronicDe novo--Yuen2017 G
SLC35F1     14590.p1chr6:
118354725-118354725
AAAACintronicDe novo--Werling2018 G
SLC35F1     2-1005-003chr6:
118550361-118550361
AGintronicDe novo--Yuen2017 G
SLC35F1     1-0388-003chr6:
118320421-118320421
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More