or
or
Exact

Results for "C3orf58"

Variant Events: 108

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
C3orf58     AU3763305chr3:
144131433-144131433
GTintergenicDe novo--Yuen2017 G
C3orf58     1-0551-004chr3:
144469555-144469555
CTintergenicDe novo--Yuen2017 G
C3orf58     2-1364-003chr3:
145301491-145301491
TCintergenicDe novo--Yuen2017 G
C3orf58     AU3905302chr3:
145185077-145185077
CTintergenicDe novo--Yuen2017 G
C3orf58     1-0756-004chr3:
145125154-145125154
GAintergenicDe novo--Yuen2017 G
C3orf58     1-0493-003chr3:
144728198-144728213
CTGTGTGTGTGTGTGTCTGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
C3orf58     AU3760302chr3:
145009398-145009404
TAAAAAATAAAAAAAintergenicDe novo--Yuen2017 G
C3orf58     AU3840302chr3:
144933485-144933485
GTintergenicDe novo--Yuen2017 G
C3orf58     2-1250-003chr3:
145125154-145125154
GAintergenicDe novo--Yuen2017 G
C3orf58     AU008505chr3:
144155749-144155749
GAintergenicDe novo--Yuen2017 G
C3orf58     3-0432-000chr3:
144904088-144904088
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
C3orf58     A4chr3:
144893896-144893896
ACintergenicDe novo--Wu2018 G
C3orf58     5-0030-003chr3:
145244336-145244336
GGGCintergenicDe novo--Yuen2017 G
C3orf58     AU3858303chr3:
145731693-145731693
GAintergenicDe novo--Yuen2017 G
C3orf58     7-0253-003chr3:
144712215-144712215
CTintergenicDe novo--Yuen2017 G
C3orf58     2-1281-003chr3:
145704494-145704494
ACintergenicDe novo--Yuen2017 G
C3orf58     2-1358-003chr3:
145774639-145774639
TGintergenicDe novo--Yuen2017 G
C3orf58     AU002903chr3:
143795299-143795299
CTintergenicDe novo--Yuen2017 G
C3orf58     AU3881302chr3:
143884383-143884383
GAintergenicDe novo--Yuen2017 G
C3orf58     AU3808305chr3:
143920052-143920052
GTintergenicDe novo--Yuen2017 G
C3orf58     7-0254-003chr3:
144171980-144171980
ACintergenicDe novo--Yuen2017 G
C3orf58     2-1288-003chr3:
144464925-144464925
TCintergenicDe novo--Yuen2017 G
C3orf58     1-0394-003chr3:
145415347-145415347
AGintergenicDe novo--Yuen2017 G
C3orf58     1-0524-003chr3:
145076923-145076928
AAGTAGAAGTAGTAGintergenicDe novo--Yuen2017 G
C3orf58     1-0547-003chr3:
143986304-143986304
TCintergenicDe novo--Yuen2017 G
C3orf58     AU4067303chr3:
145718485-145718485
GCintergenicDe novo--Yuen2017 G
C3orf58     2-0208-003chr3:
144910449-144910449
CGintergenicDe novo--Yuen2017 G
C3orf58     5-0105-003chr3:
145160078-145160078
GAintergenicDe novo--Yuen2017 G
C3orf58     1-0213-003chr3:
144041259-144041259
CAintergenicDe novo--Yuen2016 G
C3orf58     1-0203-003chr3:
145185094-145185094
AAGintergenicDe novo--Yuen2017 G
C3orf58     2-1562-004chr3:
145244336-145244336
GGGCintergenicDe novo--Yuen2017 G
C3orf58     1-0665-003chr3:
144640444-144640444
TAintergenicDe novo--Yuen2017 G
C3orf58     1-0701-003chr3:
145044042-145044042
CAintergenicDe novo--Yuen2017 G
C3orf58     1-0112-003chr3:
144020547-144020551
CTTCTCintergenicDe novo--Yuen2017 G
C3orf58     5-0015-004chr3:
145738995-145738995
AGintergenicDe novo--Yuen2017 G
C3orf58     2-0145-003chr3:
143798423-143798423
GAintergenicDe novo--Yuen2017 G
C3orf58     AU4007302chr3:
145155883-145155883
TCintergenicDe novo--Yuen2017 G
C3orf58     12568.p1chr3:
145184891-145184891
ATintergenicDe novo--Turner2016 G
C3orf58     1-0226-005chr3:
145195628-145195628
TGintergenicDe novo--Yuen2017 G
C3orf58     AU4356302chr3:
145566307-145566307
GAintergenicDe novo--Yuen2017 G
C3orf58     13515.p1chr3:
143854758-143854758
CTintergenicDe novo--Turner2016 G
C3orf58     1-0175-004chr3:
145244336-145244336
GGGCintergenicDe novo--Yuen2017 G
C3orf58     AU012803chr3:
145772397-145772397
GTintergenicDe novo--Yuen2017 G
C3orf58     AU031404chr3:
143760213-143760213
ACintergenicDe novo--Yuen2017 G
C3orf58     AU2129303chr3:
145782777-145782777
CTintergenicDe novo--Yuen2017 G
C3orf58     1-0526-003chr3:
145408420-145408420
TCintergenicDe novo--Yuen2017 G
C3orf58     5-0065-003chr3:
144918225-144918225
AGintergenicDe novo--Yuen2017 G
C3orf58     1-0303-003chr3:
145276411-145276413
CCTCintergenicDe novo--Yuen2017 G
C3orf58     AU3768302chr3:
144584171-144584171
GAintergenicDe novo--Yuen2017 G
C3orf58     AU073003chr3:
143758981-143758981
CAintergenicDe novo--Yuen2017 G
C3orf58     AU4235303chr3:
145683646-145683646
CTintergenicDe novo--Yuen2017 G
C3orf58     1-0755-003chr3:
144179685-144179685
AGintergenicDe novo--Yuen2017 G
C3orf58     2-1258-003chr3:
145733159-145733159
GCintergenicDe novo--Yuen2017 G
C3orf58     AU066818chr3:
144319485-144319485
TCintergenicDe novo--Yuen2017 G
C3orf58     1-0244-003chr3:
145031673-145031673
TCintergenicDe novo--Yuen2017 G
C3orf58     2-1205-003chr3:
144361111-144361111
ACintergenicDe novo--Yuen2017 G
C3orf58     AU3052302chr3:
145059494-145059494
CTintergenicDe novo--Yuen2017 G
C3orf58     2-1005-003chr3:
144340595-144340595
CAintergenicDe novo--Yuen2017 G
C3orf58     7-0106-003chr3:
145742956-145742956
GAintergenicDe novo--Yuen2017 G
C3orf58     044-07-107700chr3:
143704443-143704443
TCexonicDe novononsynonymous SNVNM_001134470
NM_173552
c.T89C
c.T716C
p.M30T
p.M239T
16.17-Satterstrom2020 E
C3orf58     11285.p1chr3:
145590998-145590998
CTintergenicDe novo--Werling2018 G
C3orf58     1-0395-003chr3:
144780591-144780591
CAintergenicDe novo--Yuen2017 G
C3orf58     2-1451-003chr3:
144147139-144147139
AGintergenicDe novo--Yuen2017 G
C3orf58     1-0448-003chr3:
144371383-144371383
GAintergenicDe novo--Yuen2017 G
C3orf58     1-0059-003chr3:
144260953-144260953
AGintergenicDe novo--Yuen2017 G
C3orf58     2-1230-003chr3:
144278041-144278041
CTintergenicDe novo--Yuen2016 G
C3orf58     AU4444304chr3:
145557472-145557472
GTintergenicDe novo--Yuen2017 G
C3orf58     2-1525-003chr3:
143879399-143879399
AGintergenicDe novo--Yuen2017 G
C3orf58     2-1292-004chr3:
145258815-145258815
GAintergenicDe novo--Yuen2017 G
C3orf58     AU031003chr3:
145137894-145137894
AGintergenicDe novo--Yuen2017 G
C3orf58     1-0936-003chr3:
143937559-143937566
AACTTACTAACTintergenicDe novo--Yuen2017 G
C3orf58     2-1736-003chr3:
143978929-143978929
GAintergenicDe novo--Yuen2017 G
C3orf58     A26chr3:
144253445-144253447
ACTAintergenicDe novo--Wu2018 G
C3orf58     2-1725-003chr3:
144518613-144518613
GAintergenicDe novo--Yuen2017 G
C3orf58     2-1725-003chr3:
145420075-145420075
TCintergenicDe novo--Yuen2017 G
C3orf58     1-0459-003chr3:
144010615-144010615
TCintergenicDe novo--Yuen2017 G
C3orf58     AU2023302chr3:
144401664-144401664
CTintergenicDe novo--Yuen2017 G
C3orf58     1-0381-003chr3:
145313974-145313974
GAintergenicDe novo--Yuen2017 G
C3orf58     2-0142-003chr3:
143805795-143805795
ATintergenicDe novo--Yuen2017 G
C3orf58     1-0563-003chr3:
144783561-144783561
CTintergenicDe novo--Yuen2017 G
C3orf58     2-0006-004chr3:
145537637-145537637
ACintergenicDe novo--Yuen2017 G
C3orf58     1-0299-003chr3:
144234680-144234680
CGintergenicDe novo--Yuen2017 G
C3orf58     5-0004-003chr3:
145458540-145458540
GAintergenicDe novo--Yuen2017 G
C3orf58     2-0270-003chr3:
145241672-145241672
CTintergenicDe novo--Yuen2017 G
C3orf58     AU3371305chr3:
144294255-144294255
CTintergenicDe novo--Yuen2017 G
C3orf58     2-0272-004chr3:
143862632-143862632
AGintergenicDe novo--Yuen2017 G
C3orf58     AU3680301chr3:
144437908-144437908
TAintergenicDe novo--Yuen2017 G
C3orf58     1-0186-004chr3:
143949023-143949026
AGAGAintergenicDe novo--Yuen2017 G
C3orf58     1-0158-012chr3:
145764770-145764770
GGAAATCTACCACCAAGATintergenicDe novo--Yuen2017 G
C3orf58     AU3635301chr3:
144118649-144118649
GAintergenicDe novo--Yuen2017 G
C3orf58     1-0126-004chr3:
145244336-145244336
GGGCintergenicDe novo--Yuen2017 G
C3orf58     1-0632-003chr3:
145052842-145052842
AGintergenicDe novo--Yuen2017 G
C3orf58     2-0022-004chr3:
143868510-143868510
AGintergenicDe novo--Yuen2017 G
C3orf58     AU1894304chr3:
145412607-145412607
GAintergenicDe novo--Yuen2017 G
C3orf58     2-0244-004chr3:
144527691-144527691
GCintergenicDe novo--Yuen2017 G
C3orf58     1-0553-003chr3:
145773963-145773970
CATGGTTACintergenicDe novo--Yuen2017 G
C3orf58     AU3051303chr3:
143935339-143935339
CGintergenicDe novo--Yuen2017 G
C3orf58     2-1120-003chr3:
145244336-145244336
GGGCintergenicDe novo--Yuen2017 G
C3orf58     AU2793302chr3:
144186962-144186962
GTintergenicDe novo--Yuen2017 G
C3orf58     2-1350-003chr3:
145125154-145125154
GAintergenicDe novo--Yuen2017 G
C3orf58     1-0006-004chr3:
145195730-145195730
ACintergenicDe novo--Yuen2017 G
C3orf58     1-0006-004chr3:
145195483-145195483
ACintergenicDe novo--Yuen2017 G
C3orf58     7-0273-003chr3:
144313028-144313028
CTintergenicDe novo--Yuen2017 G
C3orf58     A21chr3:
145668371-145668371
GCintergenicDe novo--Wu2018 G
C3orf58     2-1086-003chr3:
144461539-144461539
TCintergenicDe novo--Yuen2017 G
C3orf58     2-1342-003chr3:
144154837-144154837
CTintergenicDe novo--Yuen2017 G
C3orf58     1-0358-003chr3:
143972171-143972175
CCTGTCintergenicDe novo--Yuen2017 G
C3orf58     AU031403chr3:
145318637-145318637
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More