or
or
Exact

Results for "C8orf48"

Variant Events: 33

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
C8orf48     AU045512chr8:
13832667-13832667
GAintergenicDe novo--Yuen2017 G
C8orf48     AU056604chr8:
13648413-13648413
CGintergenicDe novo--Yuen2017 G
C8orf48     1-0296-004chr8:
13545691-13545691
TAintergenicDe novo--Yuen2017 G
C8orf48     A28chr8:
13620366-13620366
GAintergenicDe novo--Wu2018 G
C8orf48     1-0383-003chr8:
13650968-13650968
CTintergenicDe novo--Yuen2017 G
C8orf48     1-0049-004chr8:
13726838-13726838
GTintergenicDe novo--Yuen2017 G
C8orf48     AU1795302chr8:
13901097-13901097
CTintergenicDe novo--Yuen2017 G
C8orf48     1-0049-004chr8:
13726339-13726339
CGintergenicDe novo--Yuen2017 G
C8orf48     12636.p1chr8:
13817790-13817790
GCintergenicDe novo--Werling2018 G
C8orf48     1-0010-003chr8:
13613999-13613999
CTintergenicDe novo--Yuen2017 G
C8orf48     2-1277-003chr8:
13656193-13656193
ACintergenicDe novo--Yuen2017 G
C8orf48     1-0252-003chr8:
13561660-13561660
TCintergenicDe novo--Yuen2017 G
C8orf48     2-1322-003chr8:
13668210-13668210
GAintergenicDe novo--Yuen2017 G
C8orf48     5-0055-003chr8:
13497651-13497651
AGintergenicDe novo--Yuen2017 G
C8orf48     AU3057302chr8:
13470156-13470156
GTintergenicDe novo--Yuen2017 G
C8orf48     AU2458302chr8:
13637351-13637351
CGintergenicDe novo--Yuen2017 G
C8orf48     2-1322-004chr8:
13668210-13668210
GAintergenicDe novo--Yuen2017 G
C8orf48     AU2525302chr8:
13752794-13752794
ATintergenicDe novo--Yuen2017 G
C8orf48     A10chr8:
13551908-13551908
AGintergenicDe novo--Wu2018 G
C8orf48     3-0134-000chr8:
13550717-13550717
GAintergenicDe novo--Yuen2017 G
C8orf48     AU1635302chr8:
13449302-13449302
GAintergenicDe novo--Yuen2017 G
C8orf48     1-0446-003chr8:
13470212-13470212
AGintergenicDe novo--Yuen2017 G
C8orf48     AU4235301chr8:
13928030-13928030
CTintergenicDe novo--Yuen2017 G
C8orf48     2-1509-003chr8:
13832528-13832540
CTGTGTGTGTGTGCTGTGTGTGTGintergenicDe novo--Yuen2017 G
C8orf48     2-0127-004chr8:
13539891-13539891
CAintergenicDe novo--Yuen2017 G
C8orf48     AU2950302chr8:
13533440-13533440
GTintergenicDe novo--Yuen2017 G
C8orf48     1-0138-003chr8:
13561660-13561660
TCintergenicDe novo--Yuen2017 G
C8orf48     AU3506303chr8:
13852339-13852339
TAintergenicDe novo--Yuen2017 G
C8orf48     3-0430-000chr8:
13513375-13513375
TGintergenicDe novo--Yuen2016 G
C8orf48     2-0202-004chr8:
13561660-13561660
TCintergenicDe novo--Yuen2017 G
C8orf48     7-0095-003chr8:
13696483-13696483
AGintergenicDe novo--Yuen2017 G
C8orf48     AU3610302chr8:
13465440-13465441
AGAintergenicDe novo--Yuen2017 G
C8orf48     2-1581-003chr8:
13780358-13780358
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More