or
or
Exact

Results for "MIR8068"

Variant Events: 83

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MIR8068     2-1720-003chr11:
28951969-28951969
CTintergenicDe novo--Yuen2017 G
MIR8068     1-0303-003chr11:
28640128-28640128
CTintergenicDe novo--Yuen2017 G
MIR8068     AU3911301chr11:
29798833-29798833
TCintergenicDe novo--Yuen2017 G
MIR8068     13738.p1chr11:
29423649-29423649
GAintergenicDe novo--Werling2018 G
MIR8068     1-0051-005chr11:
28931148-28931148
GAintergenicDe novo--Yuen2017 G
MIR8068     AU3951302chr11:
29887500-29887500
AGintergenicDe novo--Yuen2017 G
MIR8068     2-0309-005chr11:
29620220-29620251
CAAAATAATTCACTTAAAAGGACCATTAACCTCintergenicDe novo--Yuen2017 G
MIR8068     1-0092-004chr11:
29626867-29626867
GAintergenicDe novo--Yuen2017 G
MIR8068     AU3702307chr11:
28594907-28594907
CGintergenicDe novo--Yuen2017 G
MIR8068     AU4013302chr11:
29811467-29811467
AGintergenicDe novo--Yuen2017 G
MIR8068     2-1416-003chr11:
28778778-28778778
CTintergenicDe novo--Yuen2017 G
MIR8068     AU2787301chr11:
28732483-28732483
TCintergenicDe novo--Yuen2017 G
MIR8068     11341.p1chr11:
28890596-28890596
ACintergenicDe novo--Turner2016 G
MIR8068     1-0218-004chr11:
29880934-29880934
GCintergenicDe novo--Yuen2017 G
MIR8068     AU3885305chr11:
29191421-29191421
TCintergenicDe novo--Yuen2017 G
MIR8068     1-0300-004chr11:
29395980-29395980
CTintergenicDe novo--Yuen2017 G
MIR8068     1-0389-004chr11:
29726487-29726487
TCintergenicDe novo--Yuen2017 G
MIR8068     7-0273-003chr11:
29073559-29073559
GCintergenicDe novo--Yuen2017 G
MIR8068     AU4467302chr11:
29347210-29347210
GAintergenicDe novo--Yuen2017 G
MIR8068     AU4306302chr11:
28793226-28793226
TAintergenicDe novo--Yuen2017 G
MIR8068     AU4467302chr11:
29347230-29347230
TAintergenicDe novo--Yuen2017 G
MIR8068     AU4188302chr11:
29993392-29993392
AGintergenicDe novo--Yuen2017 G
MIR8068     1-0352-005chr11:
29714148-29714148
ATintergenicDe novo--Yuen2017 G
MIR8068     1-0835-003chr11:
29003220-29003246
TGAGAGAGAGAGAGGGAGAGAGAGAGATGAGAGAGAGAGGGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
MIR8068     1-0352-005chr11:
29634155-29634155
TCintergenicDe novo--Yuen2017 G
MIR8068     1-0373-003chr11:
29808758-29808758
GCintergenicDe novo--Yuen2017 G
MIR8068     1-0373-003chr11:
29170473-29170473
GAintergenicDe novo--Yuen2017 G
MIR8068     1-0990-003chr11:
29641297-29641297
ATintergenicDe novo--Yuen2017 G
MIR8068     1-0572-003chr11:
29444931-29444933
TGATGAGAintergenicDe novo--Yuen2017 G
MIR8068     2-0088-003chr11:
29516957-29516957
AGintergenicDe novo--Yuen2017 G
MIR8068     2-0306-004chr11:
29153556-29153570
GCACACACACACACAGCACACACACACAintergenicDe novo--Yuen2017 G
MIR8068     7-0078-003chr11:
28524214-28524214
GTintergenicDe novo--Yuen2017 G
MIR8068     AU051503chr11:
29388896-29388896
TCintergenicDe novo--Yuen2017 G
MIR8068     AU071804chr11:
29465363-29465363
GAintergenicDe novo--Yuen2017 G
MIR8068     1-0325-003chr11:
28991778-28991778
CTintergenicDe novo--Yuen2017 G
MIR8068     AU3052301chr11:
29324718-29324718
AGintergenicDe novo--Yuen2017 G
MIR8068     5-0014-003chr11:
29516951-29516951
GGAGATintergenicDe novo--Yuen2017 G
MIR8068     1-0469-003chr11:
29410043-29410043
AAGAAACCAATCCAACACTAGTTTTCCTTTGTTCTGTGintergenicDe novo--Yuen2017 G
MIR8068     1-0330-003chr11:
29688980-29688985
CCAAAACintergenicDe novo--Yuen2017 G
MIR8068     A27 Complex Event; expand row to view variants  De novo--Wu2018 G
Wu2018 G
MIR8068     5-0138-003chr11:
29368854-29368854
CTintergenicDe novo--Yuen2017 G
MIR8068     1-0638-003chr11:
29990356-29990356
CTintergenicDe novo--Yuen2017 G
MIR8068     AU3811305chr11:
29376908-29376908
CAintergenicDe novo--Yuen2017 G
MIR8068     1-0352-003chr11:
29714148-29714148
ATintergenicDe novo--Yuen2016 G
MIR8068     A27chr11:
29149599-29149599
TCintergenicDe novo--Wu2018 G
MIR8068     1-0352-003chr11:
29634155-29634155
TCintergenicDe novo--Yuen2016 G
MIR8068     AU074503chr11:
28625588-28625588
CTintergenicDe novo--Yuen2017 G
MIR8068     AU3724301chr11:
28552597-28552597
CTintergenicDe novo--Yuen2017 G
MIR8068     2-1152-003chr11:
29170156-29170156
CAintergenicDe novo--Yuen2017 G
MIR8068     2-1194-003chr11:
28900094-28900108
AGTTTCACCTCTTTCAintergenicDe novo--Yuen2016 G
MIR8068     AU045512chr11:
29481258-29481258
ACintergenicDe novo--Yuen2017 G
MIR8068     AU2433302chr11:
28851947-28851947
AGintergenicDe novo--Yuen2017 G
MIR8068     AU3808305chr11:
29177023-29177023
GCintergenicDe novo--Yuen2017 G
MIR8068     1-0004-003chr11:
28856001-28856001
GAintergenicDe novo--Yuen2017 G
MIR8068     1-0375-003chr11:
28860304-28860304
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR8068     AU2495302chr11:
29894729-29894729
AGintergenicDe novo--Yuen2017 G
MIR8068     3-0391-000chr11:
29217010-29217010
TCintergenicDe novo--Yuen2017 G
MIR8068     AU1668302chr11:
29743061-29743061
CTintergenicDe novo--Yuen2017 G
MIR8068     AU2100302chr11:
28509016-28509016
CTintergenicDe novo--Yuen2017 G
MIR8068     AU4093304chr11:
29379929-29379929
GAintergenicDe novo--Yuen2017 G
MIR8068     AU3057302chr11:
29850138-29850138
GAintergenicDe novo--Yuen2017 G
MIR8068     2-1230-003chr11:
29136525-29136525
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR8068     AU075210chr11:
29540839-29540839
CAintergenicDe novo--Yuen2017 G
MIR8068     2-0012-003chr11:
29732454-29732454
TCintergenicDe novo--Yuen2017 G
MIR8068     2-1416-004chr11:
28778778-28778778
CTintergenicDe novo--Yuen2017 G
MIR8068     2-1437-004chr11:
29069604-29069604
TTAintergenicDe novo--Yuen2017 G
MIR8068     AU075803chr11:
29489260-29489260
CTintergenicDe novo--Yuen2017 G
MIR8068     1-0935-003chr11:
29205037-29205037
GAintergenicDe novo--Yuen2017 G
MIR8068     2-1702-004chr11:
29915694-29915694
GAintergenicDe novo--Yuen2017 G
MIR8068     2-1617-003chr11:
29079750-29079750
GTintergenicDe novo--Yuen2017 G
MIR8068     AU046703chr11:
29849444-29849444
CAintergenicDe novo--Yuen2017 G
MIR8068     1-0161-004chr11:
29808758-29808758
GCintergenicDe novo--Yuen2017 G
MIR8068     AU2129303chr11:
29796280-29796280
GAintergenicDe novo--Yuen2017 G
MIR8068     1-0295-003chr11:
28975826-28975826
AGintergenicDe novo--Yuen2017 G
MIR8068     AU3955303chr11:
29817969-29817969
TGintergenicDe novo--Yuen2017 G
MIR8068     AU4479301chr11:
29089203-29089203
GCintergenicDe novo--Yuen2017 G
MIR8068     3-0111-000chr11:
29106395-29106395
TCintergenicDe novo--Yuen2016 G
MIR8068     1-0674-003chr11:
28764908-28764908
TCintergenicDe novo--Yuen2017 G
MIR8068     AU054303chr11:
28811012-28811012
AGintergenicDe novo--Yuen2017 G
MIR8068     AU3900302chr11:
29901852-29901852
GAintergenicDe novo--Yuen2017 G
MIR8068     1-0329-004chr11:
28781532-28781532
AGintergenicDe novo--Yuen2017 G
MIR8068     AU2381302chr11:
29637863-29637863
TCintergenicDe novo--Yuen2017 G
MIR8068     1-0079-008chr11:
29245282-29245286
CTTGGCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More