or
or
Exact

Results for "EDIL3"

Variant Events: 108

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EDIL3     1-0265-004chr5:
84953716-84953716
TTCintergenicDe novo--Yuen2017 G
EDIL3     08C78430chr5:
83550047-83550047
ATintronicDe novo--Satterstrom2020 E
EDIL3     AU072004chr5:
85482153-85482153
GAintergenicDe novo--Yuen2017 G
EDIL3     7-0143-003chr5:
85083069-85083069
CTintergenicDe novo--Yuen2017 G
EDIL3     AU2792301chr5:
84724890-84724890
GAintergenicDe novo--Yuen2017 G
EDIL3     AU2988302chr5:
83476813-83476813
CTintronicDe novo--Yuen2017 G
EDIL3     7-0151-003chr5:
84858385-84858385
AGintergenicDe novo--Yuen2017 G
EDIL3     2-0242-005chr5:
84953716-84953716
TTCintergenicDe novo--Yuen2017 G
EDIL3     2-1134-003chr5:
84504733-84504733
GAintergenicDe novo--Yuen2017 G
EDIL3     AU4379301chr5:
83669297-83669297
ACintronicDe novo--Yuen2017 G
EDIL3     1-0551-004chr5:
84953716-84953716
TTCintergenicDe novo--Yuen2017 G
EDIL3     2-1339-003chr5:
84401909-84401909
CCTintergenicDe novo--Yuen2017 G
EDIL3     AU056803chr5:
83535045-83535045
GAintronicDe novo--Yuen2017 G
EDIL3     2-1254-003chr5:
83786051-83786051
TCintergenicDe novo--Yuen2017 G
EDIL3     11030.p1chr5:
83573296-83573301
TTTATATintronicUnknown--Werling2018 G
EDIL3     AU4473301chr5:
83445927-83445927
CTintronicDe novo--Yuen2017 G
EDIL3     AU0452303chr5:
84741188-84741188
AGintergenicDe novo--Yuen2017 G
EDIL3     2-1594-003chr5:
83892432-83892432
CTintergenicDe novo--Yuen2017 G
EDIL3     AU2863303chr5:
83447113-83447113
ACintronicDe novo--Yuen2017 G
EDIL3     7-0104-003chr5:
83418036-83418036
TCintronicDe novo--Yuen2017 G
EDIL3     3-0438-000chr5:
85470428-85470428
TAintergenicDe novo--Yuen2016 G
EDIL3     5-0131-003chr5:
83826105-83826105
AGintergenicDe novo--Yuen2017 G
EDIL3     1-0382-003chr5:
83690690-83690690
TCintergenicDe novo--Yuen2017 G
EDIL3     AU024104chr5:
84170013-84170013
TGintergenicDe novo--Yuen2017 G
EDIL3     1-0441-003chr5:
83273863-83273863
AGintronicDe novo--Yuen2016 G
Yuen2017 G
EDIL3     1-0408-003chr5:
85376742-85376742
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
EDIL3     2-0713-003chr5:
85120711-85120711
CAintergenicDe novo--Yuen2017 G
EDIL3     AU038204chr5:
83708796-83708796
CTintergenicDe novo--Yuen2017 G
EDIL3     AU2140306chr5:
85066860-85066860
GAintergenicDe novo--Yuen2017 G
EDIL3     1-0186-005chr5:
84641754-84641754
ACintergenicDe novo--Yuen2017 G
EDIL3     AU024608chr5:
84363652-84363652
TCintergenicDe novo--Yuen2017 G
EDIL3     AU4372309chr5:
85235994-85235994
TCintergenicDe novo--Yuen2017 G
EDIL3     AU079104chr5:
84477320-84477320
CTintergenicDe novo--Yuen2017 G
EDIL3     5-0110-003chr5:
84573899-84573899
TAintergenicDe novo--Yuen2017 G
EDIL3     AU3866301chr5:
83875641-83875641
CAintergenicDe novo--Yuen2017 G
EDIL3     AU2975301chr5:
85461311-85461313
GAAGAAAintergenicDe novo--Yuen2017 G
EDIL3     7-0219-003chr5:
84348994-84348994
TAintergenicDe novo--Yuen2017 G
EDIL3     AU2089302chr5:
84227683-84227683
CTintergenicDe novo--Yuen2017 G
EDIL3     2-1222-003chr5:
84510682-84510682
CTintergenicDe novo--Yuen2017 G
EDIL3     AU4032306chr5:
83834057-83834057
GAintergenicDe novo--Yuen2017 G
EDIL3     1-0384-003chr5:
84022291-84022291
ACintergenicDe novo--Yuen2017 G
EDIL3     AU056204chr5:
85069956-85069956
GCintergenicDe novo--Yuen2017 G
EDIL3     AU046703chr5:
83414737-83414737
CTintronicDe novo--Yuen2017 G
EDIL3     2-0278-003chr5:
83830410-83830410
TAintergenicDe novo--Yuen2017 G
EDIL3     1-0453-003chr5:
84045997-84045997
CAintergenicDe novo--Yuen2017 G
EDIL3     1-0627-005chr5:
84292576-84292576
GAintergenicDe novo--Yuen2017 G
EDIL3     1-0353-003chr5:
84555101-84555105
TACTCTintergenicDe novo--Yuen2017 G
EDIL3     3-0065-000chr5:
85344628-85344634
CAAAAAACAAAAAAAintergenicDe novo--Yuen2017 G
EDIL3     7-0008-003chr5:
85307309-85307309
ACintergenicDe novo--Yuen2017 G
EDIL3     1-0296-004chr5:
84739551-84739551
TAintergenicDe novo--Yuen2017 G
EDIL3     1-0531-003chr5:
84877646-84877646
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
EDIL3     1-0028-003chr5:
85067797-85067797
TCintergenicDe novo--Yuen2017 G
EDIL3     AU060403chr5:
84259143-84259143
TCintergenicDe novo--Yuen2017 G
EDIL3     A2chr5:
83918659-83918659
AGintergenicDe novo--Wu2018 G
EDIL3     2-1431-003chr5:
84826026-84826026
TAintergenicDe novo--Yuen2016 G
EDIL3     1-0184-003chr5:
84560046-84560046
TAintergenicDe novo--Yuen2017 G
EDIL3     2-0006-003chr5:
84867637-84867637
CTintergenicDe novo--Yuen2017 G
EDIL3     AU3398301chr5:
84833785-84833785
GCintergenicDe novo--Yuen2017 G
EDIL3     1-0153-004chr5:
84953716-84953716
TTCintergenicDe novo--Yuen2017 G
EDIL3     AU036203chr5:
83623996-83623996
TCintronicDe novo--Yuen2017 G
EDIL3     NDAR_INVEB022VLQ_wes1chr5:
83433140-83433140
TGexonicDe novononsynonymous SNVNM_001278642
NM_005711
c.A358C
c.A388C
p.N120H
p.N130H
23.3-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
EDIL3     74-0352chr5:
85066652-85066652
AGintergenicDe novo--Michaelson2012 G
EDIL3     2-1297-003chr5:
84953716-84953716
TTCintergenicDe novo--Yuen2017 G
EDIL3     1-0052-004chr5:
85408728-85408728
CTintergenicDe novo--Yuen2017 G
EDIL3     2-1591-003chr5:
83704923-83704923
GAintergenicDe novo--Yuen2017 G
EDIL3     AU3051302chr5:
85348365-85348365
CAintergenicDe novo--Yuen2017 G
EDIL3     1-0572-003chr5:
83918863-83918863
ATintergenicDe novo--Yuen2017 G
EDIL3     1-0406-003chr5:
85528810-85528810
ACintergenicDe novo--Yuen2017 G
EDIL3     5-0133-003chr5:
85041850-85041850
AGintergenicDe novo--Yuen2017 G
EDIL3     AU4310301chr5:
84175203-84175203
CTintergenicDe novo--Yuen2017 G
EDIL3     2-1525-003chr5:
83453380-83453380
ATintronicDe novo--Yuen2017 G
EDIL3     AU1668302chr5:
83275737-83275737
CCAintronicDe novo--Yuen2017 G
EDIL3     AU4228301chr5:
83781531-83781531
TCintergenicDe novo--Yuen2017 G
EDIL3     2-1402-003chr5:
85106538-85106538
CAintergenicDe novo--Yuen2017 G
EDIL3     AU3646301chr5:
85200862-85200862
TCintergenicDe novo--Yuen2017 G
EDIL3     1-0067-004chr5:
84105084-84105085
GAGintergenicDe novo--Yuen2017 G
EDIL3     AU056604chr5:
84640039-84640039
GAintergenicDe novo--Yuen2017 G
EDIL3     2-1440-003chr5:
84973115-84973115
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
EDIL3     2-0142-003chr5:
85091867-85091867
TAintergenicDe novo--Yuen2017 G
EDIL3     AU2863302chr5:
84509478-84509478
AGintergenicDe novo--Yuen2017 G
EDIL3     7-0149-003chr5:
85032818-85032818
ACintergenicDe novo--Yuen2017 G
EDIL3     AU3368303chr5:
84261398-84261398
GCintergenicDe novo--Yuen2017 G
EDIL3     AU2293301chr5:
84009540-84009540
TGintergenicDe novo--Yuen2017 G
EDIL3     1-0073-003chr5:
83274203-83274203
TCintronicDe novo--Yuen2017 G
EDIL3     AU4093301chr5:
84039018-84039018
TAintergenicDe novo--Yuen2017 G
EDIL3     AU048206chr5:
85311335-85311335
CTintergenicDe novo--Yuen2017 G
EDIL3     7-0166-003chr5:
83296088-83296093
TGTAGTTGTintronicDe novo--Yuen2017 G
EDIL3     2-0305-004chr5:
84446739-84446739
GAintergenicDe novo--Yuen2017 G
EDIL3     AU1795301chr5:
83995790-83995790
GAintergenicDe novo--Yuen2017 G
EDIL3     2-1529-003chr5:
85410195-85410195
AGintergenicDe novo--Yuen2017 G
EDIL3     2-1529-003chr5:
85370196-85370210
CAGAGAGAGAGAGAGCAGAGAGAGAGAGintergenicDe novo--Yuen2017 G
EDIL3     1-0051-005chr5:
84739650-84739650
CCATCCTGGTTAAAAAGCATCCTGGTTAAAAAGCATAAintergenicDe novo--Yuen2017 G
EDIL3     AU024004chr5:
84101245-84101245
GCintergenicDe novo--Yuen2017 G
EDIL3     2-1605-004chr5:
85163928-85163928
GAintergenicDe novo--Yuen2017 G
EDIL3     AU2072302chr5:
84254911-84254911
CTintergenicDe novo--Yuen2017 G
EDIL3     11456.p1chr5:
84083977-84083977
GAintergenicDe novo--Turner2016 G
EDIL3     13515.p1chr5:
84793489-84793489
TAintergenicDe novo--Turner2016 G
EDIL3     2-1371-003chr5:
84360187-84360187
GTintergenicDe novo--Yuen2017 G
EDIL3     13023.p1chr5:
85428835-85428835
GTintergenicDe novo--Turner2016 G
EDIL3     AU4394302chr5:
83334034-83334034
CTintronicDe novo--Yuen2017 G
EDIL3     1-0338-003chr5:
83968511-83968511
TTTGAGGintergenicDe novo--Yuen2017 G
EDIL3     5-0123-003chr5:
83962862-83962862
TCintergenicDe novo--Yuen2017 G
EDIL3     2-1267-003chr5:
84953716-84953716
TTCintergenicDe novo--Yuen2017 G
EDIL3     1-0144-005chr5:
83312068-83312068
CTintronicDe novo--Yuen2017 G
EDIL3     2-1461-003chr5:
83835306-83835306
AGintergenicDe novo--Yuen2017 G
EDIL3     1-0383-003chr5:
83741034-83741051
AAGAGAGAGAGAGAGAGAAAGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
EDIL3     2-0018-004chr5:
84188568-84188568
TCintergenicDe novo--Yuen2017 G
EDIL3     AU058104chr5:
84409045-84409045
CAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More