or
or
Exact

Results for "EXOC6"

Variant Events: 31

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EXOC6     5-0087-003chr10:
94659781-94659781
CTintronicDe novo--Trost2022 G
Yuen2017 G
EXOC6     AU002903chr10:
94802512-94802512
AGintronicDe novo--Trost2022 G
Yuen2017 G
EXOC6     1-0138-003chr10:
94598416-94598416
GTintronicDe novo--Trost2022 G
Yuen2017 G
EXOC6     2-1406-003chr10:
94737529-94737529
AGintronicDe novo--Trost2022 G
Yuen2017 G
EXOC6     1-0339-004chr10:
94667458-94667462
CAGATCintronicDe novo--Trost2022 G
Yuen2017 G
EXOC6     1-0126-003chr10:
94695124-94695124
AGintronicDe novo--Trost2022 G
Yuen2017 G
EXOC6     A4chr10:
94690262-94690262
AAAATintronicDe novo--Wu2018 G
EXOC6     1-0206-003chr10:
94700199-94700199
ATintronicDe novo--Trost2022 G
Yuen2017 G
EXOC6     5-0046-003chr10:
94720649-94720649
GTintronicDe novo--Trost2022 G
Yuen2017 G
EXOC6     1-0751-003chr10:
94754521-94754543
CAATAATAATAATAATAATAATACAATAATAATAATAATAATAintronicDe novo--Yuen2017 G
EXOC6     2-1243-003chr10:
94616402-94616402
AGintronicDe novo--Trost2022 G
EXOC6     AU0780302chr10:
94625161-94625161
CTintronicDe novo--Trost2022 G
Yuen2017 G
EXOC6     SP0075552chr10:
94733815-94733815
TCexonicDe novosynonymous SNVNM_001013848
NM_019053
c.T1764C
c.T1779C
p.A588A
p.A593A
--Fu2022 E
Trost2022 G
Zhou2022 GE
EXOC6     SP0128163chr10:
94818101-94818101
CTexonicDe novostopgainNM_001013848
NM_019053
c.C2389T
c.C2404T
p.Q797X
p.Q802X
38.0-Fu2022 E
Trost2022 G
Zhou2022 GE
EXOC6     SP0131432chr10:
94659342-94659342
AGintronicDe novo-8.569E-6Fu2022 E
EXOC6     1-0319-003chr10:
94736032-94736032
GCintronicDe novo--Trost2022 G
EXOC6     MSSNG00084-003chr10:
94743107-94743107
TCintronicDe novo--Trost2022 G
EXOC6     Codina-Sola2015:ASD_28chr10:
94594563-94594563
CCTATTexonicPaternalframeshift insertionNM_001013848c.68_69insTATTp.P23fs--Codina-Sola2015 E
EXOC6     SP0159660chr10:
94679718-94679718
TAintronicDe novo-7.0E-4Trost2022 G
EXOC6     MSSNG00020-004chr10:
94691973-94691973
GAintronicDe novo--Trost2022 G
EXOC6     1-0465-003Achr10:
94636865-94636865
GAintronicDe novo--Trost2022 G
EXOC6     SSC05299chr10:
94659341-94659341
TCintronicDe novo-8.578E-6Trost2022 G
EXOC6     1-0112-003chr10:
94620221-94620221
AGintronicDe novo--Trost2022 G
EXOC6     1-0112-003chr10:
94620231-94620232
ACGAintronicDe novo--Trost2022 G
EXOC6     2-0296-003chr10:
94641020-94641020
GCintronicDe novo--Trost2022 G
Yuen2017 G
EXOC6     12363.p1chr10:
94659341-94659341
TCintronicDe novo-8.578E-6Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
EXOC6     13649.p1chr10:
94715143-94715143
GAintronicDe novo--Turner2016 G
EXOC6     P6Q4Z_01chr10:
94782413-94782413
GAintronicDe novo--Trost2022 G
EXOC6     4-0007-003chr10:
94817463-94817463
ACintronicDe novo--Trost2022 G
EXOC6     MSSNG00081-003chr10:
94748427-94748427
AGintronicDe novo--Trost2022 G
EXOC6     4-0100-003chr10:
94768566-94768566
AGintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More